After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse IGFBP-1 ORF mammalian expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Mouse IGFBP1 cDNA Clone Product Information
NCBI RefSeq:NM_008341.4
RefSeq ORF Size:819bp
cDNA Description:Full length Clone DNA of Mus musculus insulin-like growth factor binding protein 1v with C terminal HA tag.
Gene Synonym:Igfbp1
Species:Mouse
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

IGFBP1, also known as IGFBP-1 and insulin-like growth factor-binding protein 1, is a member of the insulin-like growth factor binding protein family. IGF binding proteins (IGFBPs) are proteins of 24 to 45 kDa. All six IGFBPs share 50% homology with each other and have binding affinities for IGF-I and IGF-II at the same order of magnitude as the ligands have for the IGF-IR. IGF-binding proteins prolong the half-life of the IGFs and have been shown to either inhibit or stimulate the growth promoting effects of the IGFs on cell culture. They alter the interaction of IGFs with their cell surface receptors. IGFBP1 has an IGFBP domain and a thyroglobulin type-I domain. It binds both insulin-like growth factors (IGFs) I and II and circulates in the plasma. Binding of this protein prolongs the half-life of the IGFs and alters their interaction with cell surface receptors.

References
  • Wood AW, et al. (2005) Insulin-like growth factor signaling in fish. Int Rev Cytol. 243:215-85.
  • Firth SM, et al. (2003) Cellular actions of the insulin-like growth factor binding proteins. Endocr Rev. 23 (6):824-54.
  • Ferry RJ, et al. (1999) Insulin-like growth factor binding proteins: new proteins, new functions. Horm Res. 51(2):53-67.
  • Size / Price
    Catalog: MG50041-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"