IGF-II cDNA ORF Clone, Mouse, N-HA tag

Cat: MG50040-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IGF-II Reagents
CRO Services
Product recommended

All IGF-II Reagents
IGF-II cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
543 bp
Description
Full length Clone DNA of Mouse insulin-like growth factor 2 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IGF-II cDNA ORF Clone, Mouse, N-HA tag Alternative Names
AL033362 cDNA ORF Clone, Mouse;Igf-2 cDNA ORF Clone, Mouse;Igf-II cDNA ORF Clone, Mouse;M6pr cDNA ORF Clone, Mouse;Mpr cDNA ORF Clone, Mouse;Peg2 cDNA ORF Clone, Mouse
IGF-II Background Information

Insulin-like growth factor 2 (IGF-2/IGF-II) is a member of the insulin family of polypeptide growth factors, which are involved in development and growth. It is an imprinted gene, expressed only from the paternal allele, and epigenetic changes at this locus are associated with Wilms tumour, Beckwith-Wiedemann syndrome, rhabdomyosarcoma, and Silver-Russell syndrome. IGF-2/IGF-II is a mediator of prolactin-induced alveologenesis; prolactin, IGF-2, and cyclin D1, all of which are overexpressed in breast cancers, are components of a developmental pathway in the mammary gland. IGF-2 and exhibited statistically significant, positive associations with colorectal cancer risk when cases were confined to those diagnosed within a relatively short time period after enrolment. Circulating IGF-2 and IGFBP-3 can serve as early indicators of impending colorectal cancer. IGF-2/IGF-II appears to be involved in the progression of many tumours. It binds to at least two different types of receptor: IGF type 1 (IGF 1R) and mannose 6-phosphate/IGF type 2 (M6-P/IGF 2R). Ligand binding to IGF 1R provokes mitogenic and anti-apoptotic effects. M6-P/IGF 2R has a tumour suppressor function—it mediates IGF 2 degradation. Mutation of M6-P/IGF 2R causes both diminished growth suppression and augmented growth stimulation. The aim of this study was to investigate the role of IGF 2 and its receptors (IGF 1R and IGF 2R) in human gastric cancer.

Full Name
insulin-like growth factor 2
References
  • Harvey MB, et al. (1991) IGF-2 receptors are first expressed at the 2-cell stage of mouse development. Development. 111(4): 1057-60.
  • Peters G, et al. (2003) IGF-1R, IGF-1 and IGF-2 expression as potential prognostic and predictive markers in colorectal-cancer. Virchows Arch. 443(2): 139-45.
  • Burrow S, et al. (1998) Expression of insulin-like growth factor receptor, IGF-1, and IGF-2 in primary and metastatic osteosarcoma. J Surg Oncol. 69(1): 21-7.
  • IGF-II cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    IGF-II cDNA ORF Clone in Cloning Vector, Canine DG70041-G
    IGF-II cDNA ORF Clone, Canine, untagged DG70041-UT
    IGF-II cDNA ORF Clone, Canine, C-GFPSpark® tag DG70041-ACG
    IGF-II Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70041-ACGLN
    IGF-II cDNA ORF Clone, Canine, C-OFPSpark® tag DG70041-ACR
    IGF-II cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70041-CF
    IGF-II cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70041-NF
    IGF-II cDNA ORF Clone, Canine, C-His tag DG70041-CH
    IGF-II cDNA ORF Clone, Canine, N-His tag DG70041-NH
    IGF-II cDNA ORF Clone, Canine, C-HA tag DG70041-CY
    IGF-II cDNA ORF Clone, Canine, N-HA tag DG70041-NY
    IGF-II cDNA ORF Clone, Canine, C-Myc tag DG70041-CM
    IGF-II cDNA ORF Clone, Canine, N-Myc tag DG70041-NM

    IGF-II cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IGF-II cDNA ORF Clone in Cloning Vector, Mouse MG50040-M
    IGF-II cDNA ORF Clone, Mouse, untagged MG50040-UT
    IGF-II cDNA ORF Clone, Mouse, untagged MG5A7633-UT
    IGF-II Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50040-ACGLN
    IGF-II Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7633-ACGLN
    IGF-II cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50040-ACG
    IGF-II cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50040-ACR
    IGF-II cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50040-CF
    IGF-II cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50040-NF
    IGF-II cDNA ORF Clone, Mouse, C-His tag MG50040-CH
    IGF-II cDNA ORF Clone, Mouse, N-His tag MG50040-NH
    IGF-II cDNA ORF Clone, Mouse, C-HA tag MG50040-CY
    IGF-II cDNA ORF Clone, Mouse, C-Myc tag MG50040-CM
    IGF-II cDNA ORF Clone, Mouse, N-Myc tag MG50040-NM
    IGF-II qPCR Primer Pairs, Mouse MP200040

    IGF-II cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IGF-II cDNA ORF Clone in Cloning Vector, Human HG13032-M
    IGF-II cDNA ORF Clone, Human, untagged HG13032-UT
    IGF-II cDNA ORF Clone, Human, C-GFPSpark® tag HG13032-ACG
    IGF-II Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13032-ACGLN
    IGF-II cDNA ORF Clone, Human, C-OFPSpark® tag HG13032-ACR
    IGF-II cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13032-CF
    IGF-II cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13032-NF
    IGF-II cDNA ORF Clone, Human, C-His tag HG13032-CH
    IGF-II cDNA ORF Clone, Human, N-His tag HG13032-NH
    IGF-II cDNA ORF Clone, Human, C-HA tag HG13032-CY
    IGF-II cDNA ORF Clone, Human, N-HA tag HG13032-NY
    IGF-II cDNA ORF Clone, Human, C-Myc tag HG13032-CM
    IGF-II cDNA ORF Clone, Human, N-Myc tag HG13032-NM
    IGF-II qPCR Primer Pairs, Human HP100850
    info info
    添加购物车成功! 添加购物车失败!