IL28B cDNA ORF Clone, Mouse, C-HA tag

Cat: MG51306-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IL28B Reagents
CRO Services
Product recommended

All IL28B Reagents
IL28B cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
624 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse interferon lambda 3 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Restriction Sites
KpnI + XbaI(6kb+0.62kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
IL28B cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information
More Information About IL28B
Entrez Gene ID

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL28B cDNA ORF Clone, Mouse, C-HA tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5612
IL28B cDNA ORF Clone, Mouse, C-HA tag Alternative Names
IFL-1 cDNA ORF Clone, Mouse;IL-28B cDNA ORF Clone, Mouse;Il28 cDNA ORF Clone, Mouse;Il28b cDNA ORF Clone, Mouse;INF-alpha cDNA ORF Clone, Mouse;INF-lambda cDNA ORF Clone, Mouse
IL28B Background Information

Interleukin-28B (IL-28B) also known as Interferon lambda-3 and IFN-lambda-3, belongs to the type III interferon family of cytokines and are highly similar to IL-29. IL-28B belongs to the newly described interferon lambda (IFNλ) family of cytokines. IL-28B is a cytokine with immunomodulatory activity. It functions in Up-regulating MHC class I antigen expression. IL-28B displays potent antiviral activity and antitumor activity. This cytokine serves as ligand for the heterodimeric class II cytokine receptor composed of IL10RB and IL28RA. The ligand/receptor complex seems to signal through the Jak-STAT pathway. IL-28B, like IL-12, is capable of robustly enhancing adaptive immunity. Moreover, we describe for the first time how IL-28B reduces regulatory T-cell populations during DNA vaccination, whereas IL-12 increases this cellular subset. We also show that IL-28B, unlike IL-12, is able to increase the percentage of splenic CD8+ T cells in vaccinated animals, and that these cells are more granular and have higher antigen-specific cytolytic degranulation compared with cells taken from animals that received IL-12 as an adjuvant.

Full Name
interferon, lambda 3
References
  • Ge D, et al.. (2009) Genetic variation in IL28B predicts hepatitis C treatment-induced viral clearance. Nature. 461(7262): 399-401.
  • Morrow MP, et al.. (2009) Comparative ability of IL-12 and IL-28B to regulate Treg populations and enhance adaptive cellular immunity. Blood. 113(23): 5868-77.
  • Sheppard P, et al.. (2003) IL-28, IL-29 and their class II cytokine receptor IL-28R. Nat Immunol. 4(1): 63-8.
  • info info
    添加购物车成功! 添加购物车失败!