IFNGR2 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG50665-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IFNGR2 Reagents
CRO Services
Product recommended

All IFNGR2 Reagents
IFNGR2 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
999 bp
Description
Full length Clone DNA of Mouse interferon gamma receptor 2 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IFNGR2 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
Ifgr2 cDNA ORF Clone, Mouse;Ifgt cDNA ORF Clone, Mouse
IFNGR2 Background Information

Interferon gamma receptor beta chain (IFNgammaR2), also known as IFNGR2, belongs to the type II cytokine receptor family, whose deficiency is a cause of autosomal recessive mendelian susceptibility to mycobacterial disease (MSMD), also known as familial disseminated atypical mycobacterial infection. This accessory factor is an integral part of the IFN-gamma signal transduction pathway and is likely to interact with GAF, JAK1, and/or JAK2. IFNGR2 is a component of the IFNgamma receptor complex along with the IFNgammaR alpha chain (IFNGR1), and is a new Bax suppressor. The C-terminal fragment (cytoplasmic domain) of IFNgammaR2 is expressed in human cancer cell lines of megakaryocytic cancer (DAMI), breast cancer (MDA-MD-468), and prostate cancer (PC3 cells). The Th1 cytokine IFNgamma, acting through its heterodimeric receptors, IFNgammaR1 and IFNgammaR2, in the induction/proliferation of Th1 cells, might suppress the Th2 responses that may underlie atopic asthma. IFNGR2 has always been seen as a key mechanism for shielding T lymphocytes from the antiproliferative effects of the IFNgamma-signal transducer and activator of transcription 1 (STAT1) pathway.

Full Name
interferon gamma receptor 2 (interferon gamma transducer 1)
References
  • Gao PS, et al. (1999). Nonpathogenic common variants of IFNGR1 and IFNGR2 in association with total serum IgE levels. Biochem Biophys Res Commun. 263(2): 425-9.
  • Regis G, et al. (2006). IFNgammaR2 trafficking tunes IFNgamma-STAT1 signaling in T lymphocytes. Trends Immunol. 27(2):96-101.
  • Al-Muhsen S, et al. (2008). The genetic heterogeneity of mendelian susceptibility to mycobacterial diseases. J Allergy Clin Immunol. 122 (6): 1043-51.
  • Gomez JA, et al. (2009). The C-terminus of interferon gamma receptor beta chain (IFNgammaR2) has antiapoptotic activity as a Bax inhibitor. Cancer Biol Ther. 8(18): 1771-86.
  •  

    IFNGR2 related areas, pathways, and other information

    info info
    添加购物车成功! 添加购物车失败!