Quick Order

Mouse IFNGR2 Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Mouse IFNGR2 cDNA Clone Product Information
NCBI RefSeq:NM_008338.3
RefSeq ORF Size:999bp
cDNA Description:Full length Clone DNA of Mus musculus interferon gamma receptor 2 with N terminal HA tag.
Gene Synonym:Ifgt, Ifgr2, Ifngr2
Species:Mouse
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Interferon gamma receptor beta chain (IFNgammaR2), also known as IFNGR2, belongs to the type II cytokine receptor family, whose deficiency is a cause of autosomal recessive mendelian susceptibility to mycobacterial disease (MSMD), also known as familial disseminated atypical mycobacterial infection. This accessory factor is an integral part of the IFN-gamma signal transduction pathway and is likely to interact with GAF, JAK1, and/or JAK2. IFNGR2 is a component of the IFNgamma receptor complex along with the IFNgammaR alpha chain (IFNGR1), and is a new Bax suppressor. The C-terminal fragment (cytoplasmic domain) of IFNgammaR2 is expressed in human cancer cell lines of megakaryocytic cancer (DAMI), breast cancer (MDA-MD-468), and prostate cancer (PC3 cells). The Th1 cytokine IFNgamma, acting through its heterodimeric receptors, IFNgammaR1 and IFNgammaR2, in the induction/proliferation of Th1 cells, might suppress the Th2 responses that may underlie atopic asthma. IFNGR2 has always been seen as a key mechanism for shielding T lymphocytes from the antiproliferative effects of the IFNgamma-signal transducer and activator of transcription 1 (STAT1) pathway.

References
  • Gao PS, et al. (1999). Nonpathogenic common variants of IFNGR1 and IFNGR2 in association with total serum IgE levels. Biochem Biophys Res Commun. 263(2): 425-9.
  • Regis G, et al. (2006). IFNgammaR2 trafficking tunes IFNgamma-STAT1 signaling in T lymphocytes. Trends Immunol. 27(2):96-101.
  • Al-Muhsen S, et al. (2008). The genetic heterogeneity of mendelian susceptibility to mycobacterial diseases. J Allergy Clin Immunol. 122 (6): 1043-51.
  • Gomez JA, et al. (2009). The C-terminus of interferon gamma receptor beta chain (IFNgammaR2) has antiapoptotic activity as a Bax inhibitor. Cancer Biol Ther. 8(18): 1771-86.
  •  

    IFNGR2 related areas, pathways, and other information

    Size / Price
    Catalog: MG50665-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"