Quick Order

Mouse IFNGR2 ORF mammalian expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Mouse IFNGR2 cDNA Clone Product Information
NCBI RefSeq:NM_008338.3
RefSeq ORF Size:999bp
cDNA Description:Full length Clone DNA of Mus musculus interferon gamma receptor 2 with C terminal Myc tag.
Gene Synonym:Ifgt, Ifgr2, Ifngr2
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Interferon gamma receptor beta chain (IFNgammaR2), also known as IFNGR2, belongs to the type II cytokine receptor family, whose deficiency is a cause of autosomal recessive mendelian susceptibility to mycobacterial disease (MSMD), also known as familial disseminated atypical mycobacterial infection. This accessory factor is an integral part of the IFN-gamma signal transduction pathway and is likely to interact with GAF, JAK1, and/or JAK2. IFNGR2 is a component of the IFNgamma receptor complex along with the IFNgammaR alpha chain (IFNGR1), and is a new Bax suppressor. The C-terminal fragment (cytoplasmic domain) of IFNgammaR2 is expressed in human cancer cell lines of megakaryocytic cancer (DAMI), breast cancer (MDA-MD-468), and prostate cancer (PC3 cells). The Th1 cytokine IFNgamma, acting through its heterodimeric receptors, IFNgammaR1 and IFNgammaR2, in the induction/proliferation of Th1 cells, might suppress the Th2 responses that may underlie atopic asthma. IFNGR2 has always been seen as a key mechanism for shielding T lymphocytes from the antiproliferative effects of the IFNgamma-signal transducer and activator of transcription 1 (STAT1) pathway.

References
  • Gao PS, et al. (1999). Nonpathogenic common variants of IFNGR1 and IFNGR2 in association with total serum IgE levels. Biochem Biophys Res Commun. 263(2): 425-9.
  • Regis G, et al. (2006). IFNgammaR2 trafficking tunes IFNgamma-STAT1 signaling in T lymphocytes. Trends Immunol. 27(2):96-101.
  • Al-Muhsen S, et al. (2008). The genetic heterogeneity of mendelian susceptibility to mycobacterial diseases. J Allergy Clin Immunol. 122 (6): 1043-51.
  • Gomez JA, et al. (2009). The C-terminus of interferon gamma receptor beta chain (IFNgammaR2) has antiapoptotic activity as a Bax inhibitor. Cancer Biol Ther. 8(18): 1771-86.
  •  

    IFNGR2 related areas, pathways, and other information

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"