Quick Order

Text Size:AAA

Mouse IFNB1 ORF mammalian expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Mouse IFNB1 cDNA Clone Product Information
NCBI RefSeq:NM_010510.1
RefSeq ORF Size:549bp
cDNA Description:Full length Clone DNA of Mus musculus interferon beta 1, fibroblast with N terminal HA tag.
Gene Synonym:Ifb, IFNB, IFN-beta, Ifnb1
Species:Mouse
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Interferons (IFNs) are natural glycoproteins belonging to the cytokine superfamily, and are produced by the cells of the immune system of most vertebrates in response to challenges by foreign agents such as viruses, parasites and tumor cells. Interferon-beta (IFN beta) is an extra-cellular protein mediator of host defense and homeostasis. IFN beta has well-established direct antiviral, antiproliferative and immunomodulatory properties. Recombinant IFN beta is approved for the treatment of relapsing-remitting multiple sclerosis. The recombinant IFN beta protein has the theoretical potential to either treat or cause autoimmune neuromuscular disorders by altering the complicated and delicate balances within the immune system networks. It is the most widely prescribed disease-modifying therapy for multiple sclerosis (MS). Large-scale clinical trials have established the clinical efficacy of IFN beta in reducing relapses and slowing disease progression in relapsing-remitting MS. IFN beta therapy was shown to be comparably beneficial for opticospinal MS (OSMS) and conventional MS in Japanese. IFN beta is effective in reducing relapses in secondary progressive MS and may have a modest effect in slowing disability progression. In addition to the common antiviral activity, IFN beta also induces increased production of the p53 gene product which promotes apoptosis, and thus has therapeutic effect against certain cancers. The role of IFN-beta in bone metabolism could warrant its systematic evaluation as a potential adjunct to therapeutic regimens of osteolytic diseases. Furthermore, IFN beta might play a beneficial role in the development of a chronic progressive CNS inflammation.

References
  • Kohriyama T, et al. (2008) Interferon-beta treatment for multiple sclerosis and predictors of response. Nippon Rinsho. 66(6): 1119-26.
  • Stbgen JP. (2009) Recombinant interferon-beta therapy and neuromuscular disorders. J Neuroimmunol. 212(1-2): 132-41.
  • Abraham AK, et al. (2009) Mechanisms of interferon-beta effects on bone homeostasis. Biochem Pharmacol. 77(12): 1757-62.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"