After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse IDH1 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse IDH1 cDNA Clone Product Information
NCBI RefSeq:NM_010497.3
RefSeq ORF Size:1245bp
cDNA Description:Full length Clone DNA of Mus musculus isocitrate dehydrogenase 1 (NADP+), soluble with N terminal His tag.
Gene Synonym:Id-1, Idpc, Idh-1, AI314845, AI788952, E030024J03Rik
Species:Mouse
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
References
  • Takano S, et al. (2011) Detection of IDH1 mutation in human gliomas: comparison of immunohistochemistry and sequencing. Brain Tumor Pathol. 28(2): 115-23.
  • Geisbrecht BV, et al. (1999) The human PICD gene encodes a cytoplasmic and peroxisomal NADP(+)-dependent isocitrate dehydrogenase. J Biol Chem. 274(43): 30527-30533.
  • Nekrutenko A, et al. (1998) Cytosolic isocitrate dehydrogenase in humans, mice, and voles and phylogenetic analysis of the enzyme family. Mol Biol Evol. 15(12): 1674-1684.
  • Henke B, et al. (1998) IDP3 encodes a peroxisomal NADP-dependent isocitrate dehydrogenase required for the beta-oxidation of unsaturated fatty acids. J Biol Chem. 273(6): 3702-3711.
  • Gabriel JL, et al. (1986) Activity of purified NAD-specific isocitrate dehydrogenase at modulator and substrate concentrations approximating conditions in mitochondria. Metabolism. 35(7): 661-667.
  • Size / Price
    Catalog: MG52936-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"