ICA1 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52627-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ICA1 Reagents
CRO Services
Product recommended

All ICA1 Reagents
ICA1 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1437 bp
Description
Full length Clone DNA of Mouse islet cell autoantigen 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ICA1 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
69kDa cDNA ORF Clone, Mouse;ICA69 cDNA ORF Clone, Mouse
ICA1 Background Information
Full Name
islet cell autoantigen 1, 69kDa

ICA1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ICA1 cDNA ORF Clone in Cloning Vector, Mouse MG52627-G
ICA1 cDNA ORF Clone, Mouse, untagged MG52627-UT
ICA1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52627-ACGLN
ICA1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52627-ACG
ICA1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52627-ACR
ICA1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52627-CF
ICA1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52627-NF
ICA1 cDNA ORF Clone, Mouse, C-His tag MG52627-CH
ICA1 cDNA ORF Clone, Mouse, N-His tag MG52627-NH
ICA1 cDNA ORF Clone, Mouse, C-HA tag MG52627-CY
ICA1 cDNA ORF Clone, Mouse, N-HA tag MG52627-NY
ICA1 cDNA ORF Clone, Mouse, C-Myc tag MG52627-CM
ICA1 qPCR Primer Pairs, Mouse MP202498

ICA1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ICA1 cDNA ORF Clone in Cloning Vector, Human HG19259-G
ICA1 cDNA ORF Clone, Human, untagged HG19259-UT
ICA1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG19259-ACGLN
ICA1 cDNA ORF Clone, Human, C-GFPSpark® tag HG19259-ACG
ICA1 cDNA ORF Clone, Human, N-GFPSpark® tag HG19259-ANG
ICA1 cDNA ORF Clone, Human, C-OFPSpark® tag HG19259-ACR
ICA1 cDNA ORF Clone, Human, N-OFPSpark® tag HG19259-ANR
ICA1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG19259-CF
ICA1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG19259-NF
ICA1 cDNA ORF Clone, Human, C-His tag HG19259-CH
ICA1 cDNA ORF Clone, Human, N-His tag HG19259-NH
ICA1 cDNA ORF Clone, Human, C-HA tag HG19259-CY
ICA1 cDNA ORF Clone, Human, N-HA tag HG19259-NY
ICA1 cDNA ORF Clone, Human, C-Myc tag HG19259-CM
ICA1 cDNA ORF Clone, Human, N-Myc tag HG19259-NM
info info
添加购物车成功! 添加购物车失败!