Quick Order

Mouse Hsp90ab1 Gene ORF cDNA clone expression plasmid

  • Mouse HSP90/HSP90AB1 Gene Plasmid Map 17369
DatasheetReviewsRelated ProductsProtocols
 HSP90AB1 cDNA Clone Product Information
NCBI RefSeq:NM_008302.3
RefSeq ORF Size:2175 bp
cDNA Description:Full length Clone DNA of Mus musculus heat shock protein 90 alpha (cytosolic), class B member 1.
Gene Synonym:90kDa,AL022974,C81438,Hsp84,Hsp84-1,Hsp90,Hspcb
Species:Mouse
Vector:pCMV3-untagged
Plasmid:pCMV3-mHsp90ab1
Restriction Site:KpnI(two restriction sites) + XbaI(6.1kb+1.64kb+0.54kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 24A/C,201T/C,477G/C,570A/C,1014G/A,1305A/G,1344A/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Mouse Hsp90ab1 Gene ORF cDNA clone expression plasmid on other vectors
Product nameProduct name
Size / Price
Catalog: MG57572-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability
Add to CartBulk Discount Inquiry

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"