HSPH1/Hsp105 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG50608-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HSPH1/Hsp105 Reagents
CRO Services
Product recommended

All HSPH1/Hsp105 Reagents
HSPH1/Hsp105 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2577 bp
Description
Full length Clone DNA of Mouse heat shock 105kDa/110kDa protein 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HSPH1/Hsp105 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
105kDa cDNA ORF Clone, Mouse;AI790491 cDNA ORF Clone, Mouse;hsp-E7I cDNA ORF Clone, Mouse;Hsp105 cDNA ORF Clone, Mouse;Hsp110 cDNA ORF Clone, Mouse;hsp110/105 cDNA ORF Clone, Mouse
HSPH1/Hsp105 Background Information
Full Name
heat shock 105kDa/110kDa protein 1

HSPH1/Hsp105 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HSPH1/Hsp105 cDNA ORF Clone in Cloning Vector, Mouse MG50608-M
HSPH1/Hsp105 cDNA ORF Clone, Mouse, untagged MG50608-UT
HSPH1/Hsp105 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50608-ACG
HSPH1/Hsp105 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50608-ACGLN
HSPH1/Hsp105 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50608-ANG
HSPH1/Hsp105 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50608-ACR
HSPH1/Hsp105 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50608-ANR
HSPH1/Hsp105 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50608-CF
HSPH1/Hsp105 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50608-NF
HSPH1/Hsp105 cDNA ORF Clone, Mouse, C-His tag MG50608-CH
HSPH1/Hsp105 cDNA ORF Clone, Mouse, N-His tag MG50608-NH
HSPH1/Hsp105 cDNA ORF Clone, Mouse, C-HA tag MG50608-CY
HSPH1/Hsp105 cDNA ORF Clone, Mouse, C-Myc tag MG50608-CM
HSPH1/Hsp105 cDNA ORF Clone, Mouse, N-Myc tag MG50608-NM
HSPH1/Hsp105 qPCR Primer Pairs, Mouse MP200594

HSPH1/Hsp105 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HSPH1/Hsp105 cDNA ORF Clone in Cloning Vector, Human HG12215-G
HSPH1/Hsp105 cDNA ORF Clone, Human, untagged HG12215-UT
HSPH1/Hsp105 cDNA ORF Clone, Human, C-GFPSpark® tag HG12215-ACG
HSPH1/Hsp105 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12215-ACGLN
HSPH1/Hsp105 cDNA ORF Clone, Human, N-GFPSpark® tag HG12215-ANG
HSPH1/Hsp105 cDNA ORF Clone, Human, C-OFPSpark® tag HG12215-ACR
HSPH1/Hsp105 cDNA ORF Clone, Human, N-OFPSpark® tag HG12215-ANR
HSPH1/Hsp105 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12215-CF
HSPH1/Hsp105 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12215-NF
HSPH1/Hsp105 cDNA ORF Clone, Human, C-His tag HG12215-CH
HSPH1/Hsp105 cDNA ORF Clone, Human, N-His tag HG12215-NH
HSPH1/Hsp105 cDNA ORF Clone, Human, C-HA tag HG12215-CY
HSPH1/Hsp105 cDNA ORF Clone, Human, N-HA tag HG12215-NY
HSPH1/Hsp105 cDNA ORF Clone, Human, C-Myc tag HG12215-CM
HSPH1/Hsp105 cDNA ORF Clone, Human, N-Myc tag HG12215-NM
HSPH1/Hsp105 qPCR Primer Pairs, Human HP101871
info info
添加购物车成功! 添加购物车失败!