After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse HSP90/HSP90AA1 Gene ORF cDNA clone expression plasmid, N-Flag tag

DatasheetReviewsRelated ProductsProtocols
Mouse HSP90AA1 cDNA Clone Product Information
NCBI RefSeq:BC046614.1
RefSeq ORF Size:2202bp
cDNA Description:Full length Clone DNA of Mus musculus heat shock protein 90, alpha (cytosolic), class A member 1 with N terminal Flag tag.
Gene Synonym:hsp4, 86kDa, 89kDa, Hsp89, Hsp90, Hspca, Hsp86-1, AL024080, AL024147
Species:Mouse
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Heat shock protein 90 (90 kDa heat-shock protein, HSP90) is a molecular chaperone involved in the trafficking of proteins in the cell. It is a remarkably versatile protein involved in the stress response and in normal homoeostatic control mechanisms. HSP90 interacts with 'client proteins', including protein kinases, transcription factors and others, and either facilitates their stabilization and activation or directs them for proteasomal degradation. By this means, HSP90 displays a multifaceted ability to influence signal transduction, chromatin remodelling and epigenetic regulation, development and morphological evolution. HSP90 operates as a dimer in a conformational cycle driven by ATP binding and hydrolysis at the N-terminus. Disruption of HSP90 leads to client protein degradation and often cell death. Under stressful conditions, HSP90 stabilizes its client proteins and provides protection to the cell against cellular stressors such as in cancer cells. Especially, several oncoproteins act as HSP90 client proteins and tumor cells require higher HSP90 activity than normal cells to maintain their malignancy. For this reason, Hsp90 has emerged as a promising target for anti-cancer drug development.

References
  • Pearl LH, et al. (2008) The Hsp90 molecular chaperone: an open and shut case for treatment. Biochem J. 410(3): 439-53.
  • Hahn JS. (2009) The Hsp90 chaperone machinery: from structure to drug development. BMB Rep. 42(10): 623-30.
  • Holzbeierlein JM, et al. (2010) Hsp90: a drug target? Curr Oncol Rep. 12(2): 95-101.
  • Trepel J, et al. (2010) Targeting the dynamic HSP90 complex in cancer. Nat Rev Cancer. 10(8): 537-49.
  • Size / Price
    Catalog: MG51995-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"