HSD17B4 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52990-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HSD17B4 Reagents
CRO Services
Product recommended

All HSD17B4 Reagents
HSD17B4 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2208 bp
Description
Full length Clone DNA of Mouse hydroxysteroid (17-beta) dehydrogenase 4 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HSD17B4 cDNA ORF Clone, Mouse, N-His tag Alternative Names
17-beta-HSD cDNA ORF Clone, Mouse;17[b]-HSD cDNA ORF Clone, Mouse;4 cDNA ORF Clone, Mouse;DBP cDNA ORF Clone, Mouse;MFE-2 cDNA ORF Clone, Mouse;Mfp-2 cDNA ORF Clone, Mouse;MFP2 cDNA ORF Clone, Mouse;MPF-2 cDNA ORF Clone, Mouse;perMFE-2 cDNA ORF Clone, Mouse
HSD17B4 Background Information
Full Name
hydroxysteroid (17-beta) dehydrogenase 4

HSD17B4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
HSD17B4 cDNA ORF Clone in Cloning Vector, Rat RG84180-U
HSD17B4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84180-ACGLN

HSD17B4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HSD17B4 cDNA ORF Clone in Cloning Vector, Mouse MG52990-G
HSD17B4 cDNA ORF Clone, Mouse, untagged MG52990-UT
HSD17B4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52990-ACGLN
HSD17B4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52990-ACG
HSD17B4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52990-ANG
HSD17B4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52990-ACR
HSD17B4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52990-ANR
HSD17B4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52990-CF
HSD17B4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52990-NF
HSD17B4 cDNA ORF Clone, Mouse, C-His tag MG52990-CH
HSD17B4 cDNA ORF Clone, Mouse, C-HA tag MG52990-CY
HSD17B4 cDNA ORF Clone, Mouse, N-HA tag MG52990-NY
HSD17B4 cDNA ORF Clone, Mouse, C-Myc tag MG52990-CM
HSD17B4 cDNA ORF Clone, Mouse, N-Myc tag MG52990-NM

HSD17B4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HSD17B4 cDNA ORF Clone in Cloning Vector, Human HG14956-G
HSD17B4 cDNA ORF Clone, Human, untagged HG14956-UT
HSD17B4 cDNA ORF Clone, Human, C-GFPSpark® tag HG14956-ACG
HSD17B4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14956-ACGLN
HSD17B4 cDNA ORF Clone, Human, N-GFPSpark® tag HG14956-ANG
HSD17B4 cDNA ORF Clone, Human, C-OFPSpark® tag HG14956-ACR
HSD17B4 cDNA ORF Clone, Human, N-OFPSpark® tag HG14956-ANR
HSD17B4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14956-CF
HSD17B4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14956-NF
HSD17B4 cDNA ORF Clone, Human, C-His tag HG14956-CH
HSD17B4 cDNA ORF Clone, Human, N-His tag HG14956-NH
HSD17B4 cDNA ORF Clone, Human, C-HA tag HG14956-CY
HSD17B4 cDNA ORF Clone, Human, N-HA tag HG14956-NY
HSD17B4 cDNA ORF Clone, Human, C-Myc tag HG14956-CM
HSD17B4 cDNA ORF Clone, Human, N-Myc tag HG14956-NM
HSD17B4 qPCR Primer Pairs, Human HP103585
info info
添加购物车成功! 添加购物车失败!