HSBP1 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52663-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HSBP1 Reagents
CRO Services
Product recommended

All HSBP1 Reagents
HSBP1 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
231 bp
Description
Full length Clone DNA of Mouse heat shock factor binding protein 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HSBP1 cDNA ORF Clone, Mouse, N-His tag Alternative Names
0610007A03Rik cDNA ORF Clone, Mouse;AA408769 cDNA ORF Clone, Mouse;Hsp25 cDNA ORF Clone, Mouse
HSBP1 Background Information
Full Name
heat shock factor binding protein 1

HSBP1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
HSBP1 cDNA ORF Clone in Cloning Vector, Rat RG80812-U
HSBP1 cDNA ORF Clone, Rat, untagged RG80812-UT
HSBP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80812-ACGLN
HSBP1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80812-ACG
HSBP1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80812-ANG
HSBP1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80812-ACR
HSBP1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80812-ANR
HSBP1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80812-CF
HSBP1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80812-NF
HSBP1 cDNA ORF Clone, Rat, C-His tag RG80812-CH
HSBP1 cDNA ORF Clone, Rat, N-His tag RG80812-NH
HSBP1 cDNA ORF Clone, Rat, C-HA tag RG80812-CY
HSBP1 cDNA ORF Clone, Rat, N-HA tag RG80812-NY
HSBP1 cDNA ORF Clone, Rat, C-Myc tag RG80812-CM
HSBP1 cDNA ORF Clone, Rat, N-Myc tag RG80812-NM
HSBP1 qPCR Primer Pairs, Rat RP300776

HSBP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HSBP1 cDNA ORF Clone in Cloning Vector, Mouse MG52663-U
HSBP1 cDNA ORF Clone, Mouse, untagged MG52663-UT
HSBP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52663-ACG
HSBP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52663-ACGLN
HSBP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52663-ANG
HSBP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52663-ACR
HSBP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52663-ANR
HSBP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52663-CF
HSBP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52663-NF
HSBP1 cDNA ORF Clone, Mouse, C-His tag MG52663-CH
HSBP1 cDNA ORF Clone, Mouse, C-HA tag MG52663-CY
HSBP1 cDNA ORF Clone, Mouse, N-HA tag MG52663-NY
HSBP1 cDNA ORF Clone, Mouse, C-Myc tag MG52663-CM
HSBP1 cDNA ORF Clone, Mouse, N-Myc tag MG52663-NM
HSBP1 qPCR Primer Pairs, Mouse MP202534

HSBP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HSBP1 cDNA ORF Clone in Cloning Vector, Human HG14919-G
HSBP1 cDNA ORF Clone, Human, untagged HG14919-UT
HSBP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14919-ACG
HSBP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14919-ACGLN
HSBP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14919-ANG
HSBP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14919-ACR
HSBP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14919-ANR
HSBP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14919-CF
HSBP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14919-NF
HSBP1 cDNA ORF Clone, Human, C-His tag HG14919-CH
HSBP1 cDNA ORF Clone, Human, N-His tag HG14919-NH
HSBP1 cDNA ORF Clone, Human, C-HA tag HG14919-CY
HSBP1 cDNA ORF Clone, Human, N-HA tag HG14919-NY
HSBP1 cDNA ORF Clone, Human, C-Myc tag HG14919-CM
HSBP1 cDNA ORF Clone, Human, N-Myc tag HG14919-NM
HSBP1 qPCR Primer Pairs, Human HP103548
info info
添加购物车成功! 添加购物车失败!