Quick Order

Text Size:AAA

Mouse HPGD/15-PGDH Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Mouse HPGD cDNA Clone Product Information
NCBI RefSeq:NM_008278.2
RefSeq ORF Size:810bp
cDNA Description:Full length Clone DNA of Mus musculus hydroxyprostaglandin dehydrogenase 15 (NAD) with C terminal Myc tag.
Gene Synonym:15-PGDH, AV026552, MGC14001, Hpgd
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Mouse 15-hydroxyprostaglandin dehydrogenase [NAD+], also known as Prostaglandin dehydrogenase 1, HPGD, and PGDH1, is a member of the short-chain dehydrogenases/reductases (SDR) family. Prostaglandins (PGs) play a key role in the onset of labor in many species and regulate uterine contractility and cervical dilatation. Therefore, the regulation of prostaglandin output by PG synthesizing and metabolizing enzymes in the human myometrium may determine uterine activity patterns in human labor both at preterm and at term. Prostaglandin dehydrogenase (PGDH) metabolizes prostaglandins (PGs) to render them inactive. HPGD is down-regulated by cortisol, dexamethasone and betamethasone and down-regulated in colon cancer. It is up-regulated by TGFB1. HPGD contributes to the regulation of events that are under the control of prostaglandin levels. HPGD catalyzes the NAD-dependent dehydrogenation of lipoxin A4 to form 15-oxo-lipoxin A4. and inhibits in vivo proliferation of colon cancer cells. Defects in HPGD are the cause of primary hypertrophic osteoathropathy autosomal recessive (PHOAR) , cranioosteoarthropathy (COA), and isolated congenital nail clubbing.

References
  • Patel, FA. et al., 2003, J. Clin. Endocrinol. Metab. 88: 2922-33.
  • McKeown KJ, et al.,2003, J. Clin. Endocrinol. Metab. 88 (4): 1737-41.
  • Yan, M. et al., 2004, Proc. Natl. Acad. Sci. USA. 101: 17468-73.
  • Tariq, M. et al., 2009, J Med Genet. 46 (1): 14-20.
  • Size / Price
    Catalog: MG50531-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"