HNRNPH2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51681-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All HNRNPH2 Reagents
CRO Services
Product recommended

All HNRNPH2 Reagents
HNRNPH2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1350 bp
Description
Full length Clone DNA of Mouse heterogeneous nuclear ribonucleoprotein H2
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HNRNPH2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
DXHXS1271E cDNA ORF Clone, Mouse;Ftp-3 cDNA ORF Clone, Mouse;Ftp3 cDNA ORF Clone, Mouse;H' cDNA ORF Clone, Mouse;HNRNP cDNA ORF Clone, Mouse;Hnrph2 cDNA ORF Clone, Mouse
HNRNPH2 Background Information
Full Name
heterogeneous nuclear ribonucleoprotein H2 (H')

HNRNPH2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HNRNPH2 cDNA ORF Clone in Cloning Vector, Mouse MG51681-U
HNRNPH2 cDNA ORF Clone, Mouse, untagged MG51681-UT
HNRNPH2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51681-ACGLN
HNRNPH2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51681-ACG
HNRNPH2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51681-ANG
HNRNPH2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51681-ACR
HNRNPH2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51681-ANR
HNRNPH2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51681-NF
HNRNPH2 cDNA ORF Clone, Mouse, C-His tag MG51681-CH
HNRNPH2 cDNA ORF Clone, Mouse, N-His tag MG51681-NH
HNRNPH2 cDNA ORF Clone, Mouse, C-HA tag MG51681-CY
HNRNPH2 cDNA ORF Clone, Mouse, N-HA tag MG51681-NY
HNRNPH2 cDNA ORF Clone, Mouse, C-Myc tag MG51681-CM
HNRNPH2 cDNA ORF Clone, Mouse, N-Myc tag MG51681-NM
HNRNPH2 qPCR Primer Pairs, Mouse MP201554

HNRNPH2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HNRNPH2 cDNA ORF Clone in Cloning Vector, Human HG16541-G
HNRNPH2 cDNA ORF Clone, Human, untagged HG16541-UT
HNRNPH2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16541-ACGLN
HNRNPH2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16541-ACG
HNRNPH2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16541-ANG
HNRNPH2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16541-ACR
HNRNPH2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16541-ANR
HNRNPH2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16541-CF
HNRNPH2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16541-NF
HNRNPH2 cDNA ORF Clone, Human, C-His tag HG16541-CH
HNRNPH2 cDNA ORF Clone, Human, N-His tag HG16541-NH
HNRNPH2 cDNA ORF Clone, Human, C-HA tag HG16541-CY
HNRNPH2 cDNA ORF Clone, Human, N-HA tag HG16541-NY
HNRNPH2 cDNA ORF Clone, Human, C-Myc tag HG16541-CM
HNRNPH2 cDNA ORF Clone, Human, N-Myc tag HG16541-NM
info info
添加购物车成功! 添加购物车失败!