HNMT cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51688-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HNMT Reagents
CRO Services
Product recommended

All HNMT Reagents
HNMT cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
888 bp
Description
Full length Clone DNA of Mouse histamine N-methyltransferase with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HNMT cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
1500031F01Rik cDNA ORF Clone, Mouse;AI788969 cDNA ORF Clone, Mouse
HNMT Background Information
Full Name
histamine N-methyltransferase
References
  • Yan L., et al., 2000, Pharmacogenetics 10:261-266.
  • Horton J.R., et al., 2001, Structure 9:837-849.
  • Hillier L.W., et al., 2005, Nature 434:724-731.
  • HNMT cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    HNMT cDNA ORF Clone in Cloning Vector, Mouse MG51688-G
    HNMT cDNA ORF Clone, Mouse, untagged MG51688-UT
    HNMT cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51688-ACG
    HNMT Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51688-ACGLN
    HNMT cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51688-ANG
    HNMT cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51688-ACR
    HNMT cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51688-ANR
    HNMT cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51688-NF
    HNMT cDNA ORF Clone, Mouse, C-His tag MG51688-CH
    HNMT cDNA ORF Clone, Mouse, N-His tag MG51688-NH
    HNMT cDNA ORF Clone, Mouse, C-HA tag MG51688-CY
    HNMT cDNA ORF Clone, Mouse, N-HA tag MG51688-NY
    HNMT cDNA ORF Clone, Mouse, C-Myc tag MG51688-CM
    HNMT cDNA ORF Clone, Mouse, N-Myc tag MG51688-NM
    HNMT qPCR Primer Pairs, Mouse MP201561

    HNMT cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    HNMT cDNA ORF Clone in Cloning Vector, Human HG13096-G
    HNMT cDNA ORF Clone, Human, untagged HG13096-UT
    HNMT cDNA ORF Clone, Human, C-GFPSpark® tag HG13096-ACG
    HNMT Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13096-ACGLN
    HNMT cDNA ORF Clone, Human, N-GFPSpark® tag HG13096-ANG
    HNMT cDNA ORF Clone, Human, C-OFPSpark® tag HG13096-ACR
    HNMT cDNA ORF Clone, Human, N-OFPSpark® tag HG13096-ANR
    HNMT cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13096-CF
    HNMT cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13096-NF
    HNMT cDNA ORF Clone, Human, C-His tag HG13096-CH
    HNMT cDNA ORF Clone, Human, N-His tag HG13096-NH
    HNMT cDNA ORF Clone, Human, C-HA tag HG13096-CY
    HNMT cDNA ORF Clone, Human, N-HA tag HG13096-NY
    HNMT cDNA ORF Clone, Human, C-Myc tag HG13096-CM
    HNMT cDNA ORF Clone, Human, N-Myc tag HG13096-NM
    HNMT qPCR Primer Pairs, Human HP104910
    info info
    添加购物车成功! 添加购物车失败!