HMOX2 cDNA ORF Clone, Mouse, C-His tag

Cat: MG51806-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All HMOX2 Reagents
CRO Services
Product recommended

All HMOX2 Reagents
HMOX2 cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
948 bp
Description
Full length Clone DNA of Mouse heme oxygenase (decycling) 2 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HMOX2 cDNA ORF Clone, Mouse, C-His tag Alternative Names
HO-2 cDNA ORF Clone, Mouse;HO2 cDNA ORF Clone, Mouse
HMOX2 Background Information
Full Name
heme oxygenase 2

HMOX2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HMOX2 cDNA ORF Clone in Cloning Vector, Mouse MG51806-G
HMOX2 cDNA ORF Clone, Mouse, untagged MG51806-UT
HMOX2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51806-ACGLN
HMOX2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51806-ACG
HMOX2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51806-ANG
HMOX2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51806-ACR
HMOX2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51806-ANR
HMOX2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51806-CF
HMOX2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51806-NF
HMOX2 cDNA ORF Clone, Mouse, N-His tag MG51806-NH
HMOX2 cDNA ORF Clone, Mouse, C-HA tag MG51806-CY
HMOX2 cDNA ORF Clone, Mouse, N-HA tag MG51806-NY
HMOX2 cDNA ORF Clone, Mouse, C-Myc tag MG51806-CM
HMOX2 cDNA ORF Clone, Mouse, N-Myc tag MG51806-NM
HMOX2 qPCR Primer Pairs, Mouse MP201679

HMOX2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HMOX2 cDNA ORF Clone in Cloning Vector, Human HG16938-U
HMOX2 cDNA ORF Clone, Human, untagged HG16938-UT
HMOX2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16938-ACG
HMOX2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16938-ACGLN
HMOX2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16938-ANG
HMOX2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16938-ACR
HMOX2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16938-ANR
HMOX2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16938-CF
HMOX2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16938-NF
HMOX2 cDNA ORF Clone, Human, C-His tag HG16938-CH
HMOX2 cDNA ORF Clone, Human, N-His tag HG16938-NH
HMOX2 cDNA ORF Clone, Human, C-HA tag HG16938-CY
HMOX2 cDNA ORF Clone, Human, N-HA tag HG16938-NY
HMOX2 cDNA ORF Clone, Human, C-Myc tag HG16938-CM
HMOX2 cDNA ORF Clone, Human, N-Myc tag HG16938-NM
info info
添加购物车成功! 添加购物车失败!