HMGN3 cDNA ORF Clone, Mouse, N-His tag

Cat: MG51434-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All HMGN3 Reagents
CRO Services
Product recommended

All HMGN3 Reagents
HMGN3 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
234 bp
Description
Full length Clone DNA of Mouse high mobility group nucleosomal binding domain 3 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HMGN3 cDNA ORF Clone, Mouse, N-His tag Alternative Names
1110002A15Rik cDNA ORF Clone, Mouse;6330514M13Rik cDNA ORF Clone, Mouse;BB071015 cDNA ORF Clone, Mouse;TRIP7 cDNA ORF Clone, Mouse
HMGN3 Background Information

HMGN3 belongs to the HMGN family and is expressed in kidney, lung, pancreas, testis, skeletal muscle, heart, thyroid gland, pituitary gland, prostate and uterus. Members of the HMGN family bind to nucleosomes without any specificity for the underlying DNA sequence. They affect the global and local structure of chromatin, as well as the levels of histone modifications and thus play a role in epigenetic regulation of gene expression. HMGN3 regulates the expression of the glucose transporter SLC2A2 by binding specifically to its promoter region and recruiting PDX1 and additional transcription factors. It also regulates the expression of SLC6A9, a glycine transporter which regulates the glycine concentration in synaptic junctions in the central nervous system, by binding to its transcription start site. Both insulin and glucagon levels can be affected by HMGN3. HMGN3 may play a role in ocular development and astrocyte function. It also modulates the expression of pancreatic genes involved in insulin secretion.

Full Name
high mobility group nucleosomal binding domain 3
References
  • Ueda T, et al. (2009) The nucleosome binding protein HMGN3 modulates the transcription profile of pancreatic beta cells and affects insulin secretion. Mol Cell Biol. 29(19):5264-76.
  • Lei SF, et al. (2012) Genome-wide association study identifies HMGN3 locus for spine bone size variation in Chinese. Hum Genet. 131(3):463-9.
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • HMGN3 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    HMGN3 cDNA ORF Clone in Cloning Vector, Mouse MG51434-U
    HMGN3 cDNA ORF Clone, Mouse, untagged MG51434-UT
    HMGN3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51434-ACGLN
    HMGN3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51434-ACG
    HMGN3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51434-ANG
    HMGN3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51434-ACR
    HMGN3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51434-ANR
    HMGN3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51434-CF
    HMGN3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51434-NF
    HMGN3 cDNA ORF Clone, Mouse, C-His tag MG51434-CH
    HMGN3 cDNA ORF Clone, Mouse, C-HA tag MG51434-CY
    HMGN3 cDNA ORF Clone, Mouse, N-HA tag MG51434-NY
    HMGN3 cDNA ORF Clone, Mouse, C-Myc tag MG51434-CM
    HMGN3 cDNA ORF Clone, Mouse, N-Myc tag MG51434-NM
    HMGN3 qPCR Primer Pairs, Mouse MP201318

    HMGN3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    HMGN3 cDNA ORF Clone in Cloning Vector, Human HG13914-G
    HMGN3 cDNA ORF Clone, Human, untagged HG13914-UT
    HMGN3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13914-ACGLN
    HMGN3 cDNA ORF Clone, Human, C-GFPSpark® tag HG13914-ACG
    HMGN3 cDNA ORF Clone, Human, N-GFPSpark® tag HG13914-ANG
    HMGN3 cDNA ORF Clone, Human, C-OFPSpark® tag HG13914-ACR
    HMGN3 cDNA ORF Clone, Human, N-OFPSpark® tag HG13914-ANR
    HMGN3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13914-CF
    HMGN3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13914-NF
    HMGN3 cDNA ORF Clone, Human, C-His tag HG13914-CH
    HMGN3 cDNA ORF Clone, Human, N-His tag HG13914-NH
    HMGN3 cDNA ORF Clone, Human, C-HA tag HG13914-CY
    HMGN3 cDNA ORF Clone, Human, N-HA tag HG13914-NY
    HMGN3 cDNA ORF Clone, Human, C-Myc tag HG13914-CM
    HMGN3 cDNA ORF Clone, Human, N-Myc tag HG13914-NM
    HMGN3 qPCR Primer Pairs, Human HP102578
    info info
    添加购物车成功! 添加购物车失败!