HMGN1 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52299-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HMGN1 Reagents
CRO Services
Product recommended

All HMGN1 Reagents
HMGN1 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
291 bp
Description
Full length Clone DNA of Mouse high mobility group nucleosomal binding domain 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HMGN1 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
HMG-14 cDNA ORF Clone, Mouse;Hmg14 cDNA ORF Clone, Mouse
HMGN1 Background Information
Full Name
high mobility group nucleosome binding domain 1

HMGN1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HMGN1 cDNA ORF Clone in Cloning Vector, Mouse MG52299-U
HMGN1 cDNA ORF Clone, Mouse, untagged MG52299-UT
HMGN1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52299-ACGLN
HMGN1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52299-ACG
HMGN1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52299-ANG
HMGN1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52299-ACR
HMGN1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52299-ANR
HMGN1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52299-CF
HMGN1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52299-NF
HMGN1 cDNA ORF Clone, Mouse, C-His tag MG52299-CH
HMGN1 cDNA ORF Clone, Mouse, N-His tag MG52299-NH
HMGN1 cDNA ORF Clone, Mouse, C-HA tag MG52299-CY
HMGN1 cDNA ORF Clone, Mouse, C-Myc tag MG52299-CM
HMGN1 cDNA ORF Clone, Mouse, N-Myc tag MG52299-NM
HMGN1 qPCR Primer Pairs, Mouse MP202172

HMGN1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HMGN1 cDNA ORF Clone in Cloning Vector, Human HG15087-G
HMGN1 cDNA ORF Clone, Human, untagged HG15087-UT
HMGN1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15087-ACG
HMGN1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15087-ACGLN
HMGN1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15087-ANG
HMGN1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15087-ACR
HMGN1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15087-ANR
HMGN1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15087-CF
HMGN1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15087-NF
HMGN1 cDNA ORF Clone, Human, C-His tag HG15087-CH
HMGN1 cDNA ORF Clone, Human, N-His tag HG15087-NH
HMGN1 cDNA ORF Clone, Human, C-HA tag HG15087-CY
HMGN1 cDNA ORF Clone, Human, N-HA tag HG15087-NY
HMGN1 cDNA ORF Clone, Human, C-Myc tag HG15087-CM
HMGN1 cDNA ORF Clone, Human, N-Myc tag HG15087-NM
HMGN1 qPCR Primer Pairs, Human HP103714
info info
添加购物车成功! 添加购物车失败!