HIST3H2A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51011-CF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All HIST3H2A Reagents

CRO Services

Product recommended


All HIST3H2A Reagents

HIST3H2A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
393 bp
Description
Full length Clone DNA of Mouse histone cluster 3, H2a with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HIST3H2A Background Information

Histones are a complex family of highly conserved basic proteins responsible for packaging chromosomal DNA into nucleosomes. There are subtype diversities: H1, H2A, H2B and H3 or H4. It has become more and more evident that histone modifications are key players in the regulation of chromatin states and dynamics as well as in gene expression. Therefore, histone modifications and the enzymatic machineries that set them are crucial regulators that can control cellular proliferation, differentiation, plasticity, and malignancy processes. However, extracellular histones are a double-edged sword because they also damage host tissue and may cause death. Histones bound to platelets, induced calcium influx, and recruited plasma adhesion proteins such as fibrinogen to induce platelet aggregation. Histone cluster 3, H2a also known as histone H2A (HIST3H2A) is a member of histones. Covalent modification of histones is important in regulating chromatin dynamics and transcription. One example of such modification is ubiquitination, which mainly occurs on histones H2A and H2B. E3 ubiquitin ligase complex is specific for histone H2A (HIST3H2A). Reducing the expression of Ring2 results in a dramatic decrease in the level of ubiquitinated H2A in HeLa cells. DNA damage induces monoubiquitylation of histone H2A (HIST3H2A) in the vicinity of DNA lesions.

Full Name
histone cluster 3, H2a
Research Areas
References
  • Fuchs TA, et al. (2011) Histones induce rapid and profound thrombocytopenia in mice. Blood. 118(13): 3708-14.
  • Collart D, et al. (1993) A human histone H2B.1 variant gene, located on chromosome 1, utilizes alternative 3' end processing. J Cell Biochem. 50 (4): 374-85.
  • Marzluff WF, et al. (2002) The human and mouse replication-dependent histone genes. Genomics. 80 (5): 487-98.
  • Wang HB, et al. (2004) Role of histone H2A ubiquitination in Polycomb silencing. Nature. 431: 873-8.
  • HIST3H2A cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    HIST3H2A cDNA ORF Clone in Cloning Vector, Mouse MG51011-G
    HIST3H2A cDNA ORF Clone, Mouse, untagged MG51011-UT
    HIST3H2A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51011-ACGLN
    HIST3H2A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51011-ACG
    HIST3H2A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51011-ANG
    HIST3H2A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51011-ACR
    HIST3H2A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51011-ANR
    HIST3H2A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51011-NF
    HIST3H2A cDNA ORF Clone, Mouse, C-His tag MG51011-CH
    HIST3H2A cDNA ORF Clone, Mouse, N-His tag MG51011-NH
    HIST3H2A cDNA ORF Clone, Mouse, C-HA tag MG51011-CY
    HIST3H2A cDNA ORF Clone, Mouse, N-HA tag MG51011-NY
    HIST3H2A cDNA ORF Clone, Mouse, C-Myc tag MG51011-CM
    HIST3H2A cDNA ORF Clone, Mouse, N-Myc tag MG51011-NM
    HIST3H2A qPCR Primer Pairs, Mouse MP200971

    HIST3H2A cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    HIST3H2A cDNA ORF Clone in Cloning Vector, Human HG10926-M
    HIST3H2A cDNA ORF Clone, Human, untagged HG10926-UT
    HIST3H2A cDNA ORF Clone, Human, C-GFPSpark® tag HG10926-ACG
    HIST3H2A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10926-ACGLN
    HIST3H2A cDNA ORF Clone, Human, N-GFPSpark® tag HG10926-ANG
    HIST3H2A cDNA ORF Clone, Human, C-OFPSpark® tag HG10926-ACR
    HIST3H2A cDNA ORF Clone, Human, N-OFPSpark® tag HG10926-ANR
    HIST3H2A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10926-CF
    HIST3H2A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10926-NF
    HIST3H2A cDNA ORF Clone, Human, C-His tag HG10926-CH
    HIST3H2A cDNA ORF Clone, Human, N-His tag HG10926-NH
    HIST3H2A cDNA ORF Clone, Human, C-HA tag HG10926-CY
    HIST3H2A cDNA ORF Clone, Human, N-HA tag HG10926-NY
    HIST3H2A cDNA ORF Clone, Human, C-Myc tag HG10926-CM
    HIST3H2A cDNA ORF Clone, Human, N-Myc tag HG10926-NM
    HIST3H2A qPCR Primer Pairs, Human HP100808
    info info
    添加购物车成功! 添加购物车失败!