Quick Order

Text Size:AAA

Mouse HIST3H2A ORF mammalian expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Mouse HIST3H2A cDNA Clone Product Information
NCBI RefSeq:NM_178218.3
RefSeq ORF Size:393bp
cDNA Description:Full length Clone DNA of Mus musculus histone cluster 3, H2a with C terminal Flag tag.
Gene Synonym:Hist3h2a
Species:Mouse
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Histones are a complex family of highly conserved basic proteins responsible for packaging chromosomal DNA into nucleosomes. There are subtype diversities: H1, H2A, H2B and H3 or H4. It has become more and more evident that histone modifications are key players in the regulation of chromatin states and dynamics as well as in gene expression. Therefore, histone modifications and the enzymatic machineries that set them are crucial regulators that can control cellular proliferation, differentiation, plasticity, and malignancy processes. However, extracellular histones are a double-edged sword because they also damage host tissue and may cause death. Histones bound to platelets, induced calcium influx, and recruited plasma adhesion proteins such as fibrinogen to induce platelet aggregation. Histone cluster 3, H2a also known as histone H2A (HIST3H2A) is a member of histones. Covalent modification of histones is important in regulating chromatin dynamics and transcription. One example of such modification is ubiquitination, which mainly occurs on histones H2A and H2B. E3 ubiquitin ligase complex is specific for histone H2A (HIST3H2A). Reducing the expression of Ring2 results in a dramatic decrease in the level of ubiquitinated H2A in HeLa cells. DNA damage induces monoubiquitylation of histone H2A (HIST3H2A) in the vicinity of DNA lesions.

References
  • Fuchs TA, et al. (2011) Histones induce rapid and profound thrombocytopenia in mice. Blood. 118(13): 3708-14.
  • Collart D, et al. (1993) A human histone H2B.1 variant gene, located on chromosome 1, utilizes alternative 3' end processing. J Cell Biochem. 50 (4): 374-85.
  • Marzluff WF, et al. (2002) The human and mouse replication-dependent histone genes. Genomics. 80 (5): 487-98.
  • Wang HB, et al. (2004) Role of histone H2A ubiquitination in Polycomb silencing. Nature. 431: 873-8.
  • Size / Price
    Catalog: MG51011-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"