HIGD1A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG51876-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HIGD1A Reagents
CRO Services
Product recommended

All HIGD1A Reagents
HIGD1A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
288 bp
Description
Full length Clone DNA of Mouse HIG1 domain family, member 1A with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HIGD1A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
2210020B17Rik cDNA ORF Clone, Mouse;7420700H20Rik cDNA ORF Clone, Mouse;AI303276 cDNA ORF Clone, Mouse;AW049839 cDNA ORF Clone, Mouse;Hig1 cDNA ORF Clone, Mouse;HIMP1 cDNA ORF Clone, Mouse
HIGD1A Background Information
Full Name
HIG1 hypoxia inducible domain family, member 1A

HIGD1A cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
HIGD1A cDNA ORF Clone in Cloning Vector, Canine DG70128-U

HIGD1A cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
HIGD1A cDNA ORF Clone in Cloning Vector, Rabbit TG65067-G
HIGD1A cDNA ORF Clone, Rabbit, untagged TG65067-UT
HIGD1A cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65067-ACG
HIGD1A cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65067-ANG
HIGD1A cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65067-ACR
HIGD1A cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65067-ANR
HIGD1A cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65067-CF
HIGD1A cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65067-NF
HIGD1A cDNA ORF Clone, Rabbit, C-His tag TG65067-CH
HIGD1A cDNA ORF Clone, Rabbit, N-His tag TG65067-NH
HIGD1A cDNA ORF Clone, Rabbit, C-HA tag TG65067-CY
HIGD1A cDNA ORF Clone, Rabbit, N-HA tag TG65067-NY
HIGD1A cDNA ORF Clone, Rabbit, C-Myc tag TG65067-CM
HIGD1A cDNA ORF Clone, Rabbit, N-Myc tag TG65067-NM

HIGD1A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HIGD1A cDNA ORF Clone in Cloning Vector, Mouse MG51876-G
HIGD1A cDNA ORF Clone, Mouse, untagged MG51876-UT
HIGD1A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51876-ACG
HIGD1A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51876-ACGLN
HIGD1A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51876-ANG
HIGD1A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51876-ACR
HIGD1A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51876-ANR
HIGD1A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51876-CF
HIGD1A cDNA ORF Clone, Mouse, C-His tag MG51876-CH
HIGD1A cDNA ORF Clone, Mouse, N-His tag MG51876-NH
HIGD1A cDNA ORF Clone, Mouse, C-HA tag MG51876-CY
HIGD1A cDNA ORF Clone, Mouse, N-HA tag MG51876-NY
HIGD1A cDNA ORF Clone, Mouse, C-Myc tag MG51876-CM
HIGD1A cDNA ORF Clone, Mouse, N-Myc tag MG51876-NM
HIGD1A qPCR Primer Pairs, Mouse MP201749

HIGD1A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HIGD1A cDNA ORF Clone in Cloning Vector, Human HG16194-G
HIGD1A cDNA ORF Clone, Human, untagged HG16194-UT
HIGD1A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16194-ACGLN
HIGD1A cDNA ORF Clone, Human, C-GFPSpark® tag HG16194-ACG
HIGD1A cDNA ORF Clone, Human, N-GFPSpark® tag HG16194-ANG
HIGD1A cDNA ORF Clone, Human, C-OFPSpark® tag HG16194-ACR
HIGD1A cDNA ORF Clone, Human, N-OFPSpark® tag HG16194-ANR
HIGD1A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16194-CF
HIGD1A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16194-NF
HIGD1A cDNA ORF Clone, Human, C-His tag HG16194-CH
HIGD1A cDNA ORF Clone, Human, N-His tag HG16194-NH
HIGD1A cDNA ORF Clone, Human, C-HA tag HG16194-CY
HIGD1A cDNA ORF Clone, Human, N-HA tag HG16194-NY
HIGD1A cDNA ORF Clone, Human, C-Myc tag HG16194-CM
HIGD1A cDNA ORF Clone, Human, N-Myc tag HG16194-NM
HIGD1A qPCR Primer Pairs, Human HP104962
info info
添加购物车成功! 添加购物车失败!