Quick Order

Mouse HGF/Hepatocyte Growth Factor Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Mouse HGF cDNA Clone Product Information
NCBI RefSeq:NM_010427.4
RefSeq ORF Size:2187bp
cDNA Description:Full length Clone DNA of Mus musculus hepatocyte growth factor with C terminal HA tag.
Gene Synonym:NK1, NK2, HGF/SF, SF/HGF, C230052L06Rik, Hgf
Species:Mouse
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Mouse HGF/Hepatocyte Growth Factor Gene ORF cDNA clone expression plasmid, N-HA tag on other vectors
Product nameProduct name
Background

Hepatocyte growth factor, also known as HGF, contains 4 kringle domains, 1 PAN domain and 1 peptidase S1 domain. It belongs to the peptidase S1 family, plasminogen subfamily. Hepatocyte growth factor is secreted by mesenchymal cellsas a single inactive polypeptide and is cleaved by serine proteases into a 69-kDa alpha-chain and 34-kDa beta-chain. A disulfide bond between the alpha and beta chains produces the active, heterodimeric molecule. Hepatocyte growth factor regulates cell growth, cell motility, and morphogenesis by activating a tyrosine kinase signaling cascade after binding to the proto-oncogenic c-Met receptor, and acts as a multi-functional cytokine on cells of mainly epithelial origin. Its ability to stimulate mitogenesis, cell motility, and matrix invasion gives it a central role in angiogenesis, tumorogenesis, and tissue regeneration. HGF is a potent mitogen for mature parenchymal hepatocyte cells, seems to be an hepatotrophic factor, and acts as growth factor for a broad spectrum of tissues and cell types. HGF has no detectable protease activity. Defects in hepatocyte growth factor are the cause of deafness autosomal recessive type 39. A form of profound prelingual sensorineural hearing loss. Sensorineural deafness results from damage to the neural receptors of the inner ear, the nerve pathways to the brain, or the area of the brain that receives sound information.

References
  • Naldini L, et al. (1991) Scatter factor and hepatocyte growth factor are indistinguishable ligands for the MET receptor. EMBO J. 10(10):2867-78.
  • Comoglio, et al. (1993) Structure, biosynthesis and biochemical properties of the HGF receptor in normal and malignant cells. 65:131-65.
  • Hahn W, et al. (2011) Enhanced cardioprotective effects by coexpression of two isoforms of hepatocyte growth factor from naked plasmid DNA in a rat ischemic heart disease model. The Journal of Gene Medicine. 13(10):549-55.
  • Bottaro DP, et al. (1991) Identification of the hepatocyte growth factor receptor as the c-met proto-oncogene product. Science. 251(4995):802-4.
  • Size / Price
    Catalog: MG50038-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"