HEXB cDNA ORF Clone, Mouse, N-His tag

Cat: MG52038-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HEXB Reagents
CRO Services
Product recommended

All HEXB Reagents
HEXB cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1611 bp
Description
Full length Clone DNA of Mouse hexosaminidase B with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HEXB Background Information
Full Name
hexosaminidase B (beta polypeptide)

HEXB cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
HEXB cDNA ORF Clone in Cloning Vector, Rhesus CG90687-G
HEXB cDNA ORF Clone, Rhesus, untagged CG90687-UT
HEXB Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90687-ACGLN
HEXB cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90687-ACG
HEXB cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90687-ACR
HEXB cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90687-CF
HEXB cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90687-NF
HEXB cDNA ORF Clone, Rhesus, C-His tag CG90687-CH
HEXB cDNA ORF Clone, Rhesus, N-His tag CG90687-NH
HEXB cDNA ORF Clone, Rhesus, C-HA tag CG90687-CY
HEXB cDNA ORF Clone, Rhesus, N-HA tag CG90687-NY
HEXB cDNA ORF Clone, Rhesus, C-Myc tag CG90687-CM
HEXB cDNA ORF Clone, Rhesus, N-Myc tag CG90687-NM

HEXB cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HEXB cDNA ORF Clone in Cloning Vector, Mouse MG52038-U
HEXB cDNA ORF Clone, Mouse, untagged MG52038-UT
HEXB cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52038-ACG
HEXB Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52038-ACGLN
HEXB cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52038-ANG
HEXB cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52038-ACR
HEXB cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52038-ANR
HEXB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52038-CF
HEXB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52038-NF
HEXB cDNA ORF Clone, Mouse, C-His tag MG52038-CH
HEXB cDNA ORF Clone, Mouse, C-HA tag MG52038-CY
HEXB cDNA ORF Clone, Mouse, N-HA tag MG52038-NY
HEXB cDNA ORF Clone, Mouse, C-Myc tag MG52038-CM
HEXB cDNA ORF Clone, Mouse, N-Myc tag MG52038-NM
HEXB qPCR Primer Pairs, Mouse MP201911

HEXB cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HEXB cDNA ORF Clone in Cloning Vector, Human HG13169-G
HEXB cDNA ORF Clone, Human, untagged HG13169-UT
HEXB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13169-ACGLN
HEXB cDNA ORF Clone, Human, C-GFPSpark® tag HG13169-ACG
HEXB cDNA ORF Clone, Human, C-OFPSpark® tag HG13169-ACR
HEXB cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13169-CF
HEXB cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13169-NF
HEXB cDNA ORF Clone, Human, C-His tag HG13169-CH
HEXB cDNA ORF Clone, Human, N-His tag HG13169-NH
HEXB cDNA ORF Clone, Human, C-HA tag HG13169-CY
HEXB cDNA ORF Clone, Human, N-HA tag HG13169-NY
HEXB cDNA ORF Clone, Human, C-Myc tag HG13169-CM
HEXB cDNA ORF Clone, Human, N-Myc tag HG13169-NM
HEXB qPCR Primer Pairs, Human HP101721
info info
添加购物车成功! 添加购物车失败!