HDAC8 cDNA ORF Clone, Mouse, N-His tag

Cat: MG50273-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HDAC8 Reagents
CRO Services
Product recommended

All HDAC8 Reagents
HDAC8 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1134 bp
Description
Full length Clone DNA of Mouse histone deacetylase 8 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HDAC8 cDNA ORF Clone, Mouse, N-His tag Alternative Names
2610007D20Rik cDNA ORF Clone, Mouse
HDAC8 Background Information

Histone deacetylase 8, also known as HDAC8 and HDACL1, is a nucleus and cytoplasm protein which belongs to the histone deacetylase family and HD type 1 subfamily. Histone deacetylases (HDACs) are a growing family of enzymes implicated in transcriptional regulation by affecting the acetylation state of core histones in the nucleus of cells. HDAC8 / HDACL1 is weakly expressed in most tissues. It expressed at higher level in heart, brain, kidney and pancreas and also in liver, lung, placenta, prostate and kidney. HDAC8 / HDACL1 is responsible for the deacetylation of lysine residues on the N-terminal part of the core histones ( H2A, H2B, H3 and H4 ). Histone deacetylation gives a tag for epigenetic repression and plays an important role in transcriptional regulation, cell cycle progression and developmental events. Histone deacetylases act via the formation of large multiprotein complexes. HDAC8 / HDACL1 may play a role in smooth muscle cell contractility. HDAC8 / HDACL1 may be a potential drug target for neuroblastoma differentiation therapy using selective inhibitors, avoiding unspecific side effects.

Full Name
histone deacetylase 8
References
  • Buggy JJ. et al.,2000, Biochem J. 350 (1): 199-205.
  • Krennhrubec K. et al., 2007, Bioorg Med Chem Lett. 17 (10): 2874-8.
  • Oehme I. et al., 2009, Expert Opin Investig Drugs.18 (11): 1605-17.
  • HDAC8 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    HDAC8 cDNA ORF Clone in Cloning Vector, Mouse MG50273-M
    HDAC8 cDNA ORF Clone, Mouse, untagged MG50273-UT
    HDAC8 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50273-ACG
    HDAC8 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50273-ACGLN
    HDAC8 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50273-ANG
    HDAC8 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50273-ACR
    HDAC8 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50273-ANR
    HDAC8 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50273-CF
    HDAC8 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50273-NF
    HDAC8 cDNA ORF Clone, Mouse, C-His tag MG50273-CH
    HDAC8 cDNA ORF Clone, Mouse, C-HA tag MG50273-CY
    HDAC8 cDNA ORF Clone, Mouse, N-HA tag MG50273-NY
    HDAC8 cDNA ORF Clone, Mouse, C-Myc tag MG50273-CM
    HDAC8 cDNA ORF Clone, Mouse, N-Myc tag MG50273-NM
    HDAC8 qPCR Primer Pairs, Mouse MP200297

    HDAC8 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    HDAC8 cDNA ORF Clone in Cloning Vector, Human HG10864-M
    HDAC8 cDNA ORF Clone, Human, untagged HG10864-UT
    HDAC8 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10864-ACGLN
    HDAC8 cDNA ORF Clone, Human, C-GFPSpark® tag HG10864-ACG
    HDAC8 cDNA ORF Clone, Human, N-GFPSpark® tag HG10864-ANG
    HDAC8 cDNA ORF Clone, Human, C-OFPSpark® tag HG10864-ACR
    HDAC8 cDNA ORF Clone, Human, N-OFPSpark® tag HG10864-ANR
    HDAC8 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10864-CF
    HDAC8 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10864-NF
    HDAC8 cDNA ORF Clone, Human, C-His tag HG10864-CH
    HDAC8 cDNA ORF Clone, Human, N-His tag HG10864-NH
    HDAC8 cDNA ORF Clone, Human, C-HA tag HG10864-CY
    HDAC8 cDNA ORF Clone, Human, N-HA tag HG10864-NY
    HDAC8 cDNA ORF Clone, Human, C-Myc tag HG10864-CM
    HDAC8 cDNA ORF Clone, Human, N-Myc tag HG10864-NM
    HDAC8 qPCR Primer Pairs, Human HP100754
    info info
    添加购物车成功! 添加购物车失败!