HDAC11 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51778-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All HDAC11 Reagents
CRO Services
Product recommended

All HDAC11 Reagents
HDAC11 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1044 bp
Description
Full length Clone DNA of Mouse histone deacetylase 11 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HDAC11 Background Information
Full Name
histone deacetylase 11

HDAC11 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HDAC11 cDNA ORF Clone in Cloning Vector, Mouse MG51778-U
HDAC11 cDNA ORF Clone, Mouse, untagged MG51778-UT
HDAC11 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51778-ACG
HDAC11 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51778-ACGLN
HDAC11 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51778-ANG
HDAC11 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51778-ACR
HDAC11 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51778-ANR
HDAC11 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51778-NF
HDAC11 cDNA ORF Clone, Mouse, C-His tag MG51778-CH
HDAC11 cDNA ORF Clone, Mouse, N-His tag MG51778-NH
HDAC11 cDNA ORF Clone, Mouse, C-HA tag MG51778-CY
HDAC11 cDNA ORF Clone, Mouse, N-HA tag MG51778-NY
HDAC11 cDNA ORF Clone, Mouse, C-Myc tag MG51778-CM
HDAC11 cDNA ORF Clone, Mouse, N-Myc tag MG51778-NM
HDAC11 qPCR Primer Pairs, Mouse MP201651

HDAC11 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HDAC11 cDNA ORF Clone in Cloning Vector, Human HG11490-M
HDAC11 cDNA ORF Clone, Human, untagged HG11490-UT
HDAC11 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11490-ACGLN
HDAC11 cDNA ORF Clone, Human, C-GFPSpark® tag HG11490-ACG
HDAC11 cDNA ORF Clone, Human, N-GFPSpark® tag HG11490-ANG
HDAC11 cDNA ORF Clone, Human, C-OFPSpark® tag HG11490-ACR
HDAC11 cDNA ORF Clone, Human, N-OFPSpark® tag HG11490-ANR
HDAC11 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11490-CF
HDAC11 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11490-NF
HDAC11 cDNA ORF Clone, Human, C-His tag HG11490-CH
HDAC11 cDNA ORF Clone, Human, N-His tag HG11490-NH
HDAC11 cDNA ORF Clone, Human, C-HA tag HG11490-CY
HDAC11 cDNA ORF Clone, Human, N-HA tag HG11490-NY
HDAC11 cDNA ORF Clone, Human, C-Myc tag HG11490-CM
HDAC11 cDNA ORF Clone, Human, N-Myc tag HG11490-NM
HDAC11 qPCR Primer Pairs, Human HP101366
info info
添加购物车成功! 添加购物车失败!