Quick Order

Mouse HBP1 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse HBP1 cDNA Clone Product Information
NCBI RefSeq:NM_177993.3
RefSeq ORF Size:1425bp
cDNA Description:Full length Clone DNA of Mus musculus high mobility group box transcription factor 1 with N terminal His tag.
Gene Synonym:C86454, BE629963, 1700058O05Rik, C330012F01Rik
Species:Mouse
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

HBP1 is a sequence-specific DNA-binding transcription factor. It is involved in many biological processes. It was reported that HBP1 binds to p16(INK4A) promoter and activates p16(INK4A) expression. We found that trichostatin A (TSA), an inhibitor of HDAC (histone deacetylase), induces p16(INK4A) expression in an HBP1-dependent manner. HBP1 activates or represses the expression of some specific genes during cell growth and differentiation. HBP1 was acetylated by p300/CBP in two regions: repression domain (K297/305/307) and P domain (K171/419). HBP1 acetylation after TSA treatment was confirmed by immunoprecipitation assay. HBP1 interacted with histone acetyltransferase p300 and CREB-binding protein (CBP) and also recruited p300/CBP to p16(INK4A) promoter. HBP1 acetylation at K419 plays an important role in HBP1-induced p16(INK4A) expression.

References
  • Tevosian SG. et al., 1997, Genes Dev. 11 (3): 383-96.
  • Lavender P. et al., 1997, Oncogene. 14 (22): 2721-8.
  • Swanson. et al., 2004, Nat Struct Mol Biol. 11 (8): 738-46.
  • Size / Price
    Catalog: MG51538-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"