After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse HBEGF Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse HBEGF cDNA Clone Product Information
NCBI RefSeq:NM_010415.1
RefSeq ORF Size:627bp
cDNA Description:Full length Clone DNA of Mus musculus heparin-binding EGF-like growth factor with N terminal His tag.
Gene Synonym:DTS, Dtr, Hegfl, HB-EGF, AW047313, MGC107656, Hbegf
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Heparin-binding EGF-like growth factor (HBEGF), a member of the EGF family of growth factors, exerts its biological activity through activation of the EGFR and other ErbB receptors. Soluble mature HBEGF is proteolytically processed from a larger membrane-anchored precursor and is a potent mitogen and chemotactic factor for fibroblasts, smooth muscle cells but not endothelial cells. HBEGF activates two EGF receptor subtypes, HER1 and HER4 and binds to cell surface HSPG. The transmembrane form of HBEGF is a juxtacrine growth and adhesion factor and is uniquely the receptor for diphtheria toxin. Both forms of HB-EGF participate in normal physiological processes and in pathological processes including tumor progression and metastasis, organ hyperplasia, and atherosclerotic disease. HBEGF participates in diverse biological processes, including heart development and maintenance, skin wound healing, eyelid formation, blastocyst implantation, progression of atherosclerosis and tumor formation, through the activation of signaling molecules downstream of ErbB receptors and interactions with molecules associated with HBEGF. tumor necrosis factor-alpha (TNF-alpha) and interleukin-1 beta markedly increased HB-EGF mRNA levels in HUVEC by 12- and 7-fold, respectively, and induction of the gene by TNF-alpha was both dose- and time-dependent.

References
  • Miyamoto S, et al. (2006) Heparin-binding epidermal growth factor-like growth factor as a novel targeting molecule for cancer therapy. Cancer Sci. 97(5): 341-7.
  • Raab G, et al. (1997) Heparin-binding EGF-like growth factor. Biochim Biophys Acta. 1333(3): 179-99.
  • Pathak BG, et al. (1995) Mouse chromosomal location of three EGF receptor ligands: amphiregulin (Areg), betacellulin (Btc), and heparin-binding EGF (Hegfl). Genomics. 28(1): 116-8.
  • Size / Price
    Catalog: MG50172-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"