Quick Order

Mouse TIM-1/KIM-1/HACVR Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse HAVCR1 cDNA Clone Product Information
NCBI RefSeq:NM_134248.1
RefSeq ORF Size:918bp
cDNA Description:Full length Clone DNA of Mus musculus hepatitis A virus cellular receptor 1.
Gene Synonym:Tim1, TIM-1, Timd1, AI503787, Havcr1
Species:Mouse
Vector:pCMV3-untagged
Plasmid:pCMV3-mHAVCR1
Restriction Site:KpnI + XbaI (6.1kb + 0.92kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Human HAV cellular receptor 1 (HAVCR1), also known as Kidney injury molecule 1 (KIM-1) and T cell immunoglobulinmucin 1 (TIM-1), is a type â…  integral membrane glycoprotein. KIM-1 protein is widely expressed with highest levels in kidney and testis. It has been shown to play a major role as a human susceptibility gene for asthma, allergy and autoimmunity. IgA1lambda is a specific ligand of KIM-1 protein and that their association has a synergistic effect in virus-receptor interactions. KIM-1 involves in the pathogenesis of acute kidney injury. It had been confirmed that KIM-1 is a human urinary renal dysfunction biomarker. Moreover, KIM-1 protein is a novel regulatory molecule of flow-induced calcium signaling.

References
  • Tami C, et al. (2007) Immunoglobulin A (IgA) is a natural ligand of hepatitis A virus cellular receptor 1 (HAVCR1), and the association of IgA with HAVCR1 enhances virus-receptor interactions. J Virol. 81(7): 3437-46.
  • Rees AJ, et al. (2008) Kim-1/Tim-1: from biomarker to therapeutic target? Nephrol Dial Transplant. 23(11): 3394-6.
  • Chaturvedi S, et al. (2009) Assay validation for KIM-1: human urinary renal dysfunction biomarker. Int J Biol Sci. 5(2): 128-34.
  • Size / Price
    Catalog: MG50321-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"