HACL1 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52919-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HACL1 Reagents
CRO Services
Product recommended

All HACL1 Reagents
HACL1 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1746 bp
Description
Full length Clone DNA of Mouse 2-hydroxyacyl-CoA lyase 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HACL1 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
1600020H07Rik cDNA ORF Clone, Mouse;Hpcl cDNA ORF Clone, Mouse;Phyh2 cDNA ORF Clone, Mouse
HACL1 Background Information
Full Name
2-hydroxyacyl-CoA lyase 1

HACL1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HACL1 cDNA ORF Clone in Cloning Vector, Mouse MG52919-G
HACL1 cDNA ORF Clone, Mouse, untagged MG52919-UT
HACL1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52919-ACG
HACL1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52919-ACGLN
HACL1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52919-ANG
HACL1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52919-ACR
HACL1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52919-ANR
HACL1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52919-CF
HACL1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52919-NF
HACL1 cDNA ORF Clone, Mouse, C-His tag MG52919-CH
HACL1 cDNA ORF Clone, Mouse, N-His tag MG52919-NH
HACL1 cDNA ORF Clone, Mouse, C-HA tag MG52919-CY
HACL1 cDNA ORF Clone, Mouse, C-Myc tag MG52919-CM
HACL1 cDNA ORF Clone, Mouse, N-Myc tag MG52919-NM

HACL1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HACL1 cDNA ORF Clone in Cloning Vector, Human HG11032-M
HACL1 cDNA ORF Clone in Cloning Vector, Human HG17010-U
HACL1 cDNA ORF Clone, Human, untagged HG17010-UT
HACL1 cDNA ORF Clone, Human, untagged HG11032-UT
HACL1 cDNA ORF Clone, Human, C-GFPSpark® tag HG17010-ACG
HACL1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11032-ACG
HACL1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11032-ACGLN
HACL1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17010-ACGLN
HACL1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11032-ANG
HACL1 cDNA ORF Clone, Human, N-GFPSpark® tag HG17010-ANG
HACL1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11032-ACR
HACL1 cDNA ORF Clone, Human, C-OFPSpark® tag HG17010-ACR
HACL1 cDNA ORF Clone, Human, N-OFPSpark® tag HG17010-ANR
HACL1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11032-ANR
HACL1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17010-CF
HACL1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11032-CF
HACL1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17010-NF
HACL1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11032-NF
HACL1 cDNA ORF Clone, Human, C-His tag HG11032-CH
HACL1 cDNA ORF Clone, Human, C-His tag HG17010-CH
HACL1 cDNA ORF Clone, Human, N-His tag HG17010-NH
HACL1 cDNA ORF Clone, Human, N-His tag HG11032-NH
HACL1 cDNA ORF Clone, Human, C-HA tag HG11032-CY
HACL1 cDNA ORF Clone, Human, C-HA tag HG17010-CY
HACL1 cDNA ORF Clone, Human, N-HA tag HG17010-NY
HACL1 cDNA ORF Clone, Human, N-HA tag HG11032-NY
HACL1 cDNA ORF Clone, Human, C-Myc tag HG17010-CM
HACL1 cDNA ORF Clone, Human, C-Myc tag HG11032-CM
HACL1 cDNA ORF Clone, Human, N-Myc tag HG11032-NM
HACL1 cDNA ORF Clone, Human, N-Myc tag HG17010-NM
HACL1 qPCR Primer Pairs, Human HP100990
info info
添加购物车成功! 添加购物车失败!