GSK3B cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG50650-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GSK3B Reagents
CRO Services
Product recommended

All GSK3B Reagents
GSK3B cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1263 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse glycogen synthase kinase 3 beta with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Restriction Sites
KpnI + XbaI (6kb + 1.31kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
GSK3B cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GSK3B cDNA ORF Clone, Mouse, C-Myc tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5611
GSK3B cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
7330414F15Rik cDNA ORF Clone, Mouse;8430431H08Rik cDNA ORF Clone, Mouse;C86142 cDNA ORF Clone, Mouse;GSK-3 cDNA ORF Clone, Mouse;GSK-3beta cDNA ORF Clone, Mouse;GSK3 cDNA ORF Clone, Mouse
GSK3B Background Information

GSK3B is a serine-threonine kinase, belonging to the glycogen synthase kinase subfamily. It Contains 1 protein kinase domain, and is expressed in testis, thymus, prostate and ovary and weakly expressed in lung, brain and kidney. GSK3B is involved in energy metabolism, neuronal cell development, and body pattern formation. Polymorphisms in GSK3B gene have been implicated in modifying risk of Parkinson disease, and studies in mice show that overexpression of this gene may be relevant to the pathogenesis of Alzheimer disease. GSK3B participates in the Wnt signaling pathway. It is implicated in the hormonal control of several regulatory proteins including glycogen synthase, MYB and the transcription factor JUN. Phosphorylates JUN at sites proximal to its DNA-binding domain, thereby reducing its affinity for DNA. Phosphorylates MUC1 in breast cancer cells, and decreases the interaction of MUC1 with CTNNB1/beta-catenin. GSK3B also plays an important role in ERBB2-dependent stabilization of microtubules at the cell cortex. It prevents the phosphorylation of APC and CLASP2, allowing its association with the cell membrane. In turn, membrane-bound APC allows the localization of MACF1 to the cell membrane, which is required for microtubule capture and stabilization. GSK3B phosphorylates MACF1 and this phosphorylation inhibits the binding of MACF1 to microtubules which is critical for its role in bulge stem cell migration and skin wound repair. It may be required for early embryo development and neuron differentiation.

Full Name
glycogen synthase kinase 3 beta
References
  • Bergmann C, et al. (2011) Inhibition of glycogen synthase kinase 3β induces dermal fibrosis by activation of the canonical Wnt pathway. Ann Rheum Dis. 70(12):2191-8.
  • Ban JO, et al. (2011) Troglitazone, a PPAR agonist, inhibits human prostate cancer cell growth through inactivation of NFκB via suppression of GSK-3β expression. Cancer Biol Ther. 12(4):288-96.
  • Tsukigi M, et al. (2012) Re-expression of miR-199a suppresses renal cancer cell proliferation and survival by targeting GSK-3β. Cancer Lett. 315(2):189-97.
  • Nandan D, et al. (2012) Myeloid cell IL-10 production in response to leishmania involves inactivation of glycogen synthase kinase-3β downstream of phosphatidylinositol-3 kinase. J Immunol. 188(1):367-78.
  • GSK3B cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    GSK3B cDNA ORF Clone in Cloning Vector, Mouse MG50650-M
    GSK3B cDNA ORF Clone, Mouse, untagged MG50650-UT
    GSK3B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50650-ACG
    GSK3B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50650-ACGLN
    GSK3B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50650-ANG
    GSK3B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50650-ACR
    GSK3B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50650-ANR
    GSK3B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50650-CF
    GSK3B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50650-NF
    GSK3B cDNA ORF Clone, Mouse, C-His tag MG50650-CH
    GSK3B cDNA ORF Clone, Mouse, N-His tag MG50650-NH
    GSK3B cDNA ORF Clone, Mouse, C-HA tag MG50650-CY
    GSK3B cDNA ORF Clone, Mouse, N-HA tag MG50650-NY
    GSK3B cDNA ORF Clone, Mouse, N-Myc tag MG50650-NM
    GSK3B qPCR Primer Pairs, Mouse MP200629

    GSK3B cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    GSK3B cDNA ORF Clone in Cloning Vector, Human HG10044-M
    GSK3B cDNA ORF Clone, Human, untagged HG10044-UT
    GSK3B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10044-ACGLN
    GSK3B cDNA ORF Clone, Human, C-GFPSpark® tag HG10044-ACG
    GSK3B cDNA ORF Clone, Human, N-GFPSpark® tag HG10044-ANG
    GSK3B cDNA ORF Clone, Human, C-OFPSpark® tag HG10044-ACR
    GSK3B cDNA ORF Clone, Human, N-OFPSpark® tag HG10044-ANR
    GSK3B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10044-CF
    GSK3B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10044-NF
    GSK3B cDNA ORF Clone, Human, C-His tag HG10044-CH
    GSK3B cDNA ORF Clone, Human, N-His tag HG10044-NH
    GSK3B cDNA ORF Clone, Human, C-HA tag HG10044-CY
    GSK3B cDNA ORF Clone, Human, N-HA tag HG10044-NY
    GSK3B cDNA ORF Clone, Human, C-Myc tag HG10044-CM
    GSK3B cDNA ORF Clone, Human, N-Myc tag HG10044-NM
    GSK3B qPCR Primer Pairs, Human HP100137
    info info
    添加购物车成功! 添加购物车失败!