GRHPR cDNA ORF Clone, Mouse, N-His tag

Cat: MG52650-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GRHPR Reagents
CRO Services
Product recommended

All GRHPR Reagents
GRHPR cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
987 bp
Description
Full length Clone DNA of Mouse glyoxylate reductase/hydroxypyruvate reductase with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GRHPR cDNA ORF Clone, Mouse, N-His tag Alternative Names
1110059D05Rik cDNA ORF Clone, Mouse;6430629L09Rik cDNA ORF Clone, Mouse
GRHPR Background Information
Full Name
glyoxylate reductase/hydroxypyruvate reductase

GRHPR cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GRHPR cDNA ORF Clone in Cloning Vector, Mouse MG52650-U
GRHPR cDNA ORF Clone, Mouse, untagged MG52650-UT
GRHPR cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52650-ACG
GRHPR Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52650-ACGLN
GRHPR cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52650-ANG
GRHPR cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52650-ACR
GRHPR cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52650-ANR
GRHPR cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52650-CF
GRHPR cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52650-NF
GRHPR cDNA ORF Clone, Mouse, C-His tag MG52650-CH
GRHPR cDNA ORF Clone, Mouse, C-HA tag MG52650-CY
GRHPR cDNA ORF Clone, Mouse, N-HA tag MG52650-NY
GRHPR cDNA ORF Clone, Mouse, C-Myc tag MG52650-CM
GRHPR cDNA ORF Clone, Mouse, N-Myc tag MG52650-NM
GRHPR qPCR Primer Pairs, Mouse MP202521

GRHPR cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GRHPR cDNA ORF Clone in Cloning Vector, Human HG19916-U
GRHPR cDNA ORF Clone, Human, untagged HG19916-UT
GRHPR cDNA ORF Clone, Human, C-GFPSpark® tag HG19916-ACG
GRHPR Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG19916-ACGLN
GRHPR cDNA ORF Clone, Human, N-GFPSpark® tag HG19916-ANG
GRHPR cDNA ORF Clone, Human, C-OFPSpark® tag HG19916-ACR
GRHPR cDNA ORF Clone, Human, N-OFPSpark® tag HG19916-ANR
GRHPR cDNA ORF Clone, Human, C-DDK (Flag®) tag HG19916-CF
GRHPR cDNA ORF Clone, Human, N-DDK (Flag®) tag HG19916-NF
GRHPR cDNA ORF Clone, Human, C-His tag HG19916-CH
GRHPR cDNA ORF Clone, Human, N-His tag HG19916-NH
GRHPR cDNA ORF Clone, Human, C-HA tag HG19916-CY
GRHPR cDNA ORF Clone, Human, N-HA tag HG19916-NY
GRHPR cDNA ORF Clone, Human, C-Myc tag HG19916-CM
GRHPR cDNA ORF Clone, Human, N-Myc tag HG19916-NM
info info
添加购物车成功! 添加购物车失败!