GRAMD3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG52959-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All GRAMD3 Reagents
CRO Services
Product recommended

All GRAMD3 Reagents
GRAMD3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1338 bp
Description
Full length Clone DNA of Mouse GRAM domain containing 3 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GRAMD3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
9030613F08Rik cDNA ORF Clone, Mouse;9130427A09Rik cDNA ORF Clone, Mouse;AW061306 cDNA ORF Clone, Mouse;NS3TP2 cDNA ORF Clone, Mouse
GRAMD3 Background Information
Full Name
GRAM domain containing 3

GRAMD3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GRAMD3 cDNA ORF Clone in Cloning Vector, Rat RG89992-U
GRAMD3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG89992-ACGLN

GRAMD3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GRAMD3 cDNA ORF Clone in Cloning Vector, Mouse MG52959-G
GRAMD3 cDNA ORF Clone, Mouse, untagged MG52959-UT
GRAMD3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52959-ACG
GRAMD3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52959-ACGLN
GRAMD3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52959-ANG
GRAMD3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52959-ACR
GRAMD3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52959-ANR
GRAMD3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52959-CF
GRAMD3 cDNA ORF Clone, Mouse, C-His tag MG52959-CH
GRAMD3 cDNA ORF Clone, Mouse, N-His tag MG52959-NH
GRAMD3 cDNA ORF Clone, Mouse, C-HA tag MG52959-CY
GRAMD3 cDNA ORF Clone, Mouse, N-HA tag MG52959-NY
GRAMD3 cDNA ORF Clone, Mouse, C-Myc tag MG52959-CM
GRAMD3 cDNA ORF Clone, Mouse, N-Myc tag MG52959-NM

GRAMD3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GRAMD3 cDNA ORF Clone in Cloning Vector, Human HG26592-U
GRAMD3 cDNA ORF Clone, Human, untagged HG26592-UT
GRAMD3 cDNA ORF Clone, Human, C-GFPSpark® tag HG26592-ACG
GRAMD3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG26592-ACGLN
GRAMD3 cDNA ORF Clone, Human, N-GFPSpark® tag HG26592-ANG
GRAMD3 cDNA ORF Clone, Human, C-OFPSpark® tag HG26592-ACR
GRAMD3 cDNA ORF Clone, Human, N-OFPSpark® tag HG26592-ANR
GRAMD3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG26592-CF
GRAMD3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG26592-NF
GRAMD3 cDNA ORF Clone, Human, C-His tag HG26592-CH
GRAMD3 cDNA ORF Clone, Human, N-His tag HG26592-NH
GRAMD3 cDNA ORF Clone, Human, C-HA tag HG26592-CY
GRAMD3 cDNA ORF Clone, Human, N-HA tag HG26592-NY
GRAMD3 cDNA ORF Clone, Human, C-Myc tag HG26592-CM
GRAMD3 cDNA ORF Clone, Human, N-Myc tag HG26592-NM
info info
添加购物车成功! 添加购物车失败!