GPR56 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50335-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GPR56 Reagents
CRO Services
Product recommended

All GPR56 Reagents
GPR56 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2064 bp
Description
Full length Clone DNA of Mouse G protein-coupled receptor 56 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GPR56 Background Information
References
  • Liu M., et al., 1999, Genomics 55: 296-305.
  • Huang,Y. et al., 2008, Mol Cell Biochem. 308 (1-2):133-9.
  • Li,S. et al., 2008, J Neurosci 28 (22):5817-26.
  • Jin,Z. et al., 2009, Prog Mol Biol Transl Sci. 89 :1-13.
  • Xu,L. et al., 2010, Clin Exp Metastasis. 27 (4):241-9.
  • GPR56 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    GPR56 cDNA ORF Clone in Cloning Vector, Mouse MG50335-M
    GPR56 cDNA ORF Clone, Mouse, untagged MG50335-UT
    GPR56 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50335-ACG
    GPR56 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50335-ACGLN
    GPR56 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50335-ACR
    GPR56 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50335-CF
    GPR56 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50335-NF
    GPR56 cDNA ORF Clone, Mouse, C-His tag MG50335-CH
    GPR56 cDNA ORF Clone, Mouse, N-His tag MG50335-NH
    GPR56 cDNA ORF Clone, Mouse, C-HA tag MG50335-CY
    GPR56 cDNA ORF Clone, Mouse, N-HA tag MG50335-NY
    GPR56 cDNA ORF Clone, Mouse, C-Myc tag MG50335-CM
    GPR56 qPCR Primer Pairs, Mouse MP200358

    GPR56 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    GPR56 cDNA ORF Clone in Cloning Vector, Human HG11017-M
    GPR56 cDNA ORF Clone, Human, untagged HG11017-UT
    GPR56 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11017-ACGLN
    GPR56 cDNA ORF Clone, Human, C-GFPSpark® tag HG11017-ACG
    GPR56 cDNA ORF Clone, Human, C-OFPSpark® tag HG11017-ACR
    GPR56 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11017-CF
    GPR56 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11017-NF
    GPR56 cDNA ORF Clone, Human, C-His tag HG11017-CH
    GPR56 cDNA ORF Clone, Human, N-His tag HG11017-NH
    GPR56 cDNA ORF Clone, Human, C-HA tag HG11017-CY
    GPR56 cDNA ORF Clone, Human, N-HA tag HG11017-NY
    GPR56 cDNA ORF Clone, Human, C-Myc tag HG11017-CM
    GPR56 cDNA ORF Clone, Human, N-Myc tag HG11017-NM
    GPR56 qPCR Primer Pairs, Human HP100978
    info info
    添加购物车成功! 添加购物车失败!