GPNMB cDNA ORF Clone, Mouse, C-His tag

Cat: MG50475-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GPNMB Reagents
CRO Services
Product recommended

All GPNMB Reagents
GPNMB cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1725 bp
Description
Full length Clone DNA of Mouse glycoprotein (transmembrane) nmb with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GPNMB cDNA ORF Clone, Mouse, C-His tag Alternative Names
DC-HIL cDNA ORF Clone, Mouse;Dchil cDNA ORF Clone, Mouse;ipd cDNA ORF Clone, Mouse
GPNMB Background Information

GPNMB belongs to the PMEL / NMB family, also known as Osteoactivin and Hematopoietic growth factor-inducible neurokinin 1 ( HGFIN ), is a transmembrane glycoprotein that is expressed in numerous cells, including osteoclasts, macrophages, dendritic cells, and tumor cells. It is suggested to influence osteoblast maturation, cell adhesion and migration. GPNMB protein acts as a downstream mediator of BMP-2 effects on osteoblast differentiation and function. GPNMB participates in bone mineralization, and functions as a negative regulator of inflammation in macrophages. Osteoactivin is expressed at high levels in normal and inflammatory liver macrophages suggesting a significant role in acute liver injury. The early-phase upregulation of Osteoactivin expression in the tubular epithelium in response to renal injury might play a role in triggering renal interstitial fibrosis via activation of matrix metalloproteinase expression and collagen remodeling in rats. Osteoactivin as a protein that is expressed in aggressive human breast cancers and is capable of promoting breast cancer metastasis to bone.

Full Name
glycoprotein (transmembrane) nmb
References
  • Pahl MV. et al., 2010, Clin J Am Soc Nephrol. 5(1): 56-61.
  • Abdelmagid SM. et al., 2008, Exp Cell Res. 314(13): 2334-51.
  • Haralanova-Ilieva B. et al., 2005, J Hepatol. 242(4): 565-72.
  • Abdelmagid SM. et al., 2007, J Cell Physiol. 210(1): 26-37.
  • Furochi H. et al., 2007, J Med Invest. 54(3-4): 248-54.
  • GPNMB cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    GPNMB cDNA ORF Clone in Cloning Vector, Mouse MG50475-M
    GPNMB cDNA ORF Clone, Mouse, untagged MG50475-UT
    GPNMB cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50475-ACG
    GPNMB Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50475-ACGLN
    GPNMB cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50475-ACR
    GPNMB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50475-CF
    GPNMB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50475-NF
    GPNMB cDNA ORF Clone, Mouse, N-His tag MG50475-NH
    GPNMB cDNA ORF Clone, Mouse, C-HA tag MG50475-CY
    GPNMB cDNA ORF Clone, Mouse, N-HA tag MG50475-NY
    GPNMB cDNA ORF Clone, Mouse, C-Myc tag MG50475-CM
    GPNMB cDNA ORF Clone, Mouse, N-Myc tag MG50475-NM
    GPNMB qPCR Primer Pairs, Mouse MP200471

    GPNMB cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    GPNMB cDNA ORF Clone in Cloning Vector, Human HG11305-M
    GPNMB cDNA ORF Clone, Human, untagged HG11305-UT
    GPNMB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11305-ACGLN
    GPNMB cDNA ORF Clone, Human, C-GFPSpark® tag HG11305-ACG
    GPNMB cDNA ORF Clone, Human, C-OFPSpark® tag HG11305-ACR
    GPNMB cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11305-CF
    GPNMB cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11305-NF
    GPNMB cDNA ORF Clone, Human, C-His tag HG11305-CH
    GPNMB cDNA ORF Clone, Human, N-His tag HG11305-NH
    GPNMB cDNA ORF Clone, Human, C-HA tag HG11305-CY
    GPNMB cDNA ORF Clone, Human, N-HA tag HG11305-NY
    GPNMB cDNA ORF Clone, Human, C-Myc tag HG11305-CM
    GPNMB cDNA ORF Clone, Human, N-Myc tag HG11305-NM
    GPNMB qPCR Primer Pairs, Human HP101194
    info info
    添加购物车成功! 添加购物车失败!