Quick Order

Text Size:AAA

Mouse GPD1 / Glycerolphosphate Dehydrogenase 1 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse GPD1 cDNA Clone Product Information
NCBI RefSeq:NM_010271.2
RefSeq ORF Size:1050bp
cDNA Description:Full length Clone DNA of Mus musculus glycerol-3-phosphate dehydrogenase 1 (soluble) with N terminal His tag.
Gene Synonym:Gdc1, Gdc-1, AI747587, mKIAA4010
Species:Mouse
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Mouse GPD1 / Glycerolphosphate Dehydrogenase 1 Gene ORF cDNA clone expression plasmid, N-His tag on other vectors
Mouse GPD1 / Glycerolphosphate Dehydrogenase 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagMG52892-ACG$225
Mouse GPD1 / Glycerolphosphate Dehydrogenase 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagMG52892-ACR$225
Mouse GPD1 / Glycerolphosphate Dehydrogenase 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagMG52892-ANG$225
Mouse GPD1 / Glycerolphosphate Dehydrogenase 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagMG52892-ANR$225
Mouse GPD1 / Glycerolphosphate Dehydrogenase 1 Gene ORF cDNA clone expression plasmid, C-Flag tagMG52892-CF$195
Mouse GPD1 / Glycerolphosphate Dehydrogenase 1 Gene ORF cDNA clone expression plasmid, C-His tagMG52892-CH$195
Mouse GPD1 / Glycerolphosphate Dehydrogenase 1 Gene ORF cDNA clone expression plasmid, C-Myc tagMG52892-CM$195
Mouse GPD1 / Glycerolphosphate Dehydrogenase 1 Gene ORF cDNA clone expression plasmid, C-HA tagMG52892-CY$195
Mouse GPD1 / Glycerolphosphate Dehydrogenase 1 Gene ORF cDNA clone in cloning vectorMG52892-G$75
Mouse GPD1 / Glycerolphosphate Dehydrogenase 1 Gene ORF cDNA clone expression plasmid, N-Flag tagMG52892-NF$195
Mouse GPD1 / Glycerolphosphate Dehydrogenase 1 Gene ORF cDNA clone expression plasmid, N-His tagMG52892-NH$195
Mouse GPD1 / Glycerolphosphate Dehydrogenase 1 Gene ORF cDNA clone expression plasmid, N-Myc tagMG52892-NM$195
Mouse GPD1 / Glycerolphosphate Dehydrogenase 1 Gene ORF cDNA clone expression plasmid, N-HA tagMG52892-NY$195
Mouse GPD1 / Glycerolphosphate Dehydrogenase 1 Gene ORF cDNA clone expression plasmidMG52892-UT$195
 Learn more about expression Vectors
Product nameProduct name
Background

GPD1, also known as glycerolphosphate dehydrogenase 1, is a member of the NAD-dependent glycerol-3-phosphate dehydrogenase family. GPD1 catalyzes the reversible redox conversion of dihydroxyacetone phosphate (DHAP), thus plays a critical role in carbohydrate and lipid metabolism. It also reduces nicotine adenine dinucleotide (NADH) to glycerol-3-phosphate (G3P) and NAD+. Meanwhile, GPD1 and mitochondrial glycerol-3-phosphate dehydrogenase also form a glycerol phosphate shuttle that facilitates the transfer of reducing equivalents from the cytosol to mitochondria. Mutations in GPD1 gene are a cause of transient infantile hypertriglyceridemia.

References
  • Ou X. et al., 2006, J Mol Biol. 357 (3): 858-69.
  • Ou Xianjin. et al., 2011, Journal of Molecular Biology. 357 (3): 858-69.
  • Harding Jr. et al., 1975, Biochem Journal. 146: 223-9.
  • Size / Price
    Catalog: MG52892-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"