Quick Order

Text Size:AAA

Mouse GPD1 ORF mammalian expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Mouse GPD1 cDNA Clone Product Information
NCBI RefSeq:NM_010271.2
RefSeq ORF Size:1050bp
cDNA Description:Full length Clone DNA of Mus musculus glycerol-3-phosphate dehydrogenase 1 (soluble) with C terminal Myc tag.
Gene Synonym:Gdc1, Gdc-1, AI747587, mKIAA4010
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

GPD1, also known as glycerolphosphate dehydrogenase 1, is a member of the NAD-dependent glycerol-3-phosphate dehydrogenase family. GPD1 catalyzes the reversible redox conversion of dihydroxyacetone phosphate (DHAP), thus plays a critical role in carbohydrate and lipid metabolism. It also reduces nicotine adenine dinucleotide (NADH) to glycerol-3-phosphate (G3P) and NAD+. Meanwhile, GPD1 and mitochondrial glycerol-3-phosphate dehydrogenase also form a glycerol phosphate shuttle that facilitates the transfer of reducing equivalents from the cytosol to mitochondria. Mutations in GPD1 gene are a cause of transient infantile hypertriglyceridemia.

References
  • Ou X. et al., 2006, J Mol Biol. 357 (3): 858-69.
  • Ou Xianjin. et al., 2011, Journal of Molecular Biology. 357 (3): 858-69.
  • Harding Jr. et al., 1975, Biochem Journal. 146: 223-9.
  • Size / Price
    Catalog: MG52892-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"