GOLGA7 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52061-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GOLGA7 Reagents
CRO Services
Product recommended

All GOLGA7 Reagents
GOLGA7 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
414 bp
Description
Full length Clone DNA of Mouse golgi autoantigen, golgin subfamily a, 7 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GOLGA7 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
AB041568 cDNA ORF Clone, Mouse;C130038N16Rik cDNA ORF Clone, Mouse;GCP16 cDNA ORF Clone, Mouse;GOLGA3AP1 cDNA ORF Clone, Mouse;HSPC041 cDNA ORF Clone, Mouse;R75586 cDNA ORF Clone, Mouse
GOLGA7 Background Information
Full Name
golgin A7

GOLGA7 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
GOLGA7 cDNA ORF Clone in Cloning Vector, Ferret FG60112-G
GOLGA7 cDNA ORF Clone, Ferret, untagged FG60112-UT
GOLGA7 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60112-ACGLN
GOLGA7 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60112-ACG
GOLGA7 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60112-ANG
GOLGA7 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60112-ACR
GOLGA7 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60112-ANR
GOLGA7 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60112-CF
GOLGA7 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60112-NF
GOLGA7 cDNA ORF Clone, Ferret, C-His tag FG60112-CH
GOLGA7 cDNA ORF Clone, Ferret, N-His tag FG60112-NH
GOLGA7 cDNA ORF Clone, Ferret, C-HA tag FG60112-CY
GOLGA7 cDNA ORF Clone, Ferret, N-HA tag FG60112-NY
GOLGA7 cDNA ORF Clone, Ferret, C-Myc tag FG60112-CM
GOLGA7 cDNA ORF Clone, Ferret, N-Myc tag FG60112-NM

GOLGA7 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
GOLGA7 cDNA ORF Clone in Cloning Vector, Rhesus CG90362-G
GOLGA7 cDNA ORF Clone, Rhesus, untagged CG90362-UT
GOLGA7 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90362-ACG
GOLGA7 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90362-ACGLN
GOLGA7 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90362-ANG
GOLGA7 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90362-ACR
GOLGA7 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90362-ANR
GOLGA7 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90362-CF
GOLGA7 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90362-NF
GOLGA7 cDNA ORF Clone, Rhesus, C-His tag CG90362-CH
GOLGA7 cDNA ORF Clone, Rhesus, N-His tag CG90362-NH
GOLGA7 cDNA ORF Clone, Rhesus, C-HA tag CG90362-CY
GOLGA7 cDNA ORF Clone, Rhesus, N-HA tag CG90362-NY
GOLGA7 cDNA ORF Clone, Rhesus, C-Myc tag CG90362-CM
GOLGA7 cDNA ORF Clone, Rhesus, N-Myc tag CG90362-NM

GOLGA7 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GOLGA7 cDNA ORF Clone in Cloning Vector, Rat RG87362-U
GOLGA7 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG87362-ACGLN

GOLGA7 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GOLGA7 cDNA ORF Clone in Cloning Vector, Mouse MG52061-G
GOLGA7 cDNA ORF Clone, Mouse, untagged MG52061-UT
GOLGA7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52061-ACG
GOLGA7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52061-ACGLN
GOLGA7 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52061-ANG
GOLGA7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52061-ACR
GOLGA7 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52061-ANR
GOLGA7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52061-CF
GOLGA7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52061-NF
GOLGA7 cDNA ORF Clone, Mouse, C-His tag MG52061-CH
GOLGA7 cDNA ORF Clone, Mouse, N-His tag MG52061-NH
GOLGA7 cDNA ORF Clone, Mouse, C-HA tag MG52061-CY
GOLGA7 cDNA ORF Clone, Mouse, N-HA tag MG52061-NY
GOLGA7 cDNA ORF Clone, Mouse, C-Myc tag MG52061-CM
GOLGA7 qPCR Primer Pairs, Mouse MP201934

GOLGA7 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GOLGA7 cDNA ORF Clone in Cloning Vector, Human HG17104-U
GOLGA7 cDNA ORF Clone, Human, untagged HG17104-UT
GOLGA7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17104-ACGLN
GOLGA7 cDNA ORF Clone, Human, C-GFPSpark® tag HG17104-ACG
GOLGA7 cDNA ORF Clone, Human, N-GFPSpark® tag HG17104-ANG
GOLGA7 cDNA ORF Clone, Human, C-OFPSpark® tag HG17104-ACR
GOLGA7 cDNA ORF Clone, Human, N-OFPSpark® tag HG17104-ANR
GOLGA7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17104-CF
GOLGA7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17104-NF
GOLGA7 cDNA ORF Clone, Human, C-His tag HG17104-CH
GOLGA7 cDNA ORF Clone, Human, N-His tag HG17104-NH
GOLGA7 cDNA ORF Clone, Human, C-HA tag HG17104-CY
GOLGA7 cDNA ORF Clone, Human, N-HA tag HG17104-NY
GOLGA7 cDNA ORF Clone, Human, C-Myc tag HG17104-CM
GOLGA7 cDNA ORF Clone, Human, N-Myc tag HG17104-NM
info info
添加购物车成功! 添加购物车失败!