GNPDA1 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG51696-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All GNPDA1 Reagents
CRO Services
Product recommended

All GNPDA1 Reagents
GNPDA1 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
870 bp
Description
Full length Clone DNA of Mouse glucosamine-6-phosphate deaminase 1
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GNPDA1 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
Gnp1 cDNA ORF Clone, Mouse;GNPDA cDNA ORF Clone, Mouse;Gnpi cDNA ORF Clone, Mouse;oscillin cDNA ORF Clone, Mouse
GNPDA1 Background Information
Full Name
glucosamine-6-phosphate deaminase 1

GNPDA1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GNPDA1 cDNA ORF Clone in Cloning Vector, Rat RG80961-U
GNPDA1 cDNA ORF Clone, Rat, untagged RG80961-UT
GNPDA1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80961-ACGLN
GNPDA1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80961-ACG
GNPDA1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80961-ANG
GNPDA1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80961-ACR
GNPDA1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80961-ANR
GNPDA1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80961-CF
GNPDA1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80961-NF
GNPDA1 cDNA ORF Clone, Rat, C-His tag RG80961-CH
GNPDA1 cDNA ORF Clone, Rat, N-His tag RG80961-NH
GNPDA1 cDNA ORF Clone, Rat, C-HA tag RG80961-CY
GNPDA1 cDNA ORF Clone, Rat, N-HA tag RG80961-NY
GNPDA1 cDNA ORF Clone, Rat, C-Myc tag RG80961-CM
GNPDA1 cDNA ORF Clone, Rat, N-Myc tag RG80961-NM
GNPDA1 qPCR Primer Pairs, Rat RP300925

GNPDA1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GNPDA1 cDNA ORF Clone in Cloning Vector, Mouse MG51696-U
GNPDA1 cDNA ORF Clone, Mouse, untagged MG51696-UT
GNPDA1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51696-ACG
GNPDA1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51696-ACGLN
GNPDA1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51696-ANG
GNPDA1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51696-ACR
GNPDA1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51696-ANR
GNPDA1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51696-CF
GNPDA1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51696-NF
GNPDA1 cDNA ORF Clone, Mouse, C-His tag MG51696-CH
GNPDA1 cDNA ORF Clone, Mouse, N-His tag MG51696-NH
GNPDA1 cDNA ORF Clone, Mouse, C-HA tag MG51696-CY
GNPDA1 cDNA ORF Clone, Mouse, N-HA tag MG51696-NY
GNPDA1 cDNA ORF Clone, Mouse, N-Myc tag MG51696-NM
GNPDA1 qPCR Primer Pairs, Mouse MP201569

GNPDA1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GNPDA1 cDNA ORF Clone in Cloning Vector, Human HG14626-G
GNPDA1 cDNA ORF Clone, Human, untagged HG14626-UT
GNPDA1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14626-ACGLN
GNPDA1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14626-ACG
GNPDA1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14626-ANG
GNPDA1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14626-ACR
GNPDA1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14626-ANR
GNPDA1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14626-CF
GNPDA1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14626-NF
GNPDA1 cDNA ORF Clone, Human, C-His tag HG14626-CH
GNPDA1 cDNA ORF Clone, Human, N-His tag HG14626-NH
GNPDA1 cDNA ORF Clone, Human, C-HA tag HG14626-CY
GNPDA1 cDNA ORF Clone, Human, N-HA tag HG14626-NY
GNPDA1 cDNA ORF Clone, Human, C-Myc tag HG14626-CM
GNPDA1 cDNA ORF Clone, Human, N-Myc tag HG14626-NM
GNPDA1 qPCR Primer Pairs, Human HP103260
info info
添加购物车成功! 添加购物车失败!