Rack1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52808-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Rack1 Reagents
CRO Services
Product recommended

All Rack1 Reagents
Rack1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
954 bp
Description
Full length Clone DNA of Mouse guanine nucleotide binding protein (G protein), beta polypeptide 2 like 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Rack1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
AL033335 cDNA ORF Clone, Mouse;GB-like cDNA ORF Clone, Mouse;Gnb2-rs1 cDNA ORF Clone, Mouse;p205 cDNA ORF Clone, Mouse;Rack1 cDNA ORF Clone, Mouse
Rack1 Background Information

Rack1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Rack1 cDNA ORF Clone in Cloning Vector, Rat RG80679-U
Rack1 cDNA ORF Clone, Rat, untagged RG80679-UT
Rack1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80679-ACG
Rack1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80679-ACR
Rack1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80679-CF
Rack1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80679-NF
Rack1 cDNA ORF Clone, Rat, C-His tag RG80679-CH
Rack1 cDNA ORF Clone, Rat, N-His tag RG80679-NH
Rack1 cDNA ORF Clone, Rat, C-HA tag RG80679-CY
Rack1 cDNA ORF Clone, Rat, N-HA tag RG80679-NY
Rack1 cDNA ORF Clone, Rat, C-Myc tag RG80679-CM
Rack1 cDNA ORF Clone, Rat, N-Myc tag RG80679-NM
Rack1 qPCR Primer Pairs, Rat RP300643

Rack1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Rack1 cDNA ORF Clone in Cloning Vector, Mouse MG52808-G
Rack1 cDNA ORF Clone, Mouse, untagged MG52808-UT
Rack1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52808-ACG
Rack1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52808-ANG
Rack1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52808-ACR
Rack1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52808-ANR
Rack1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52808-NF
Rack1 cDNA ORF Clone, Mouse, C-His tag MG52808-CH
Rack1 cDNA ORF Clone, Mouse, N-His tag MG52808-NH
Rack1 cDNA ORF Clone, Mouse, C-HA tag MG52808-CY
Rack1 cDNA ORF Clone, Mouse, N-HA tag MG52808-NY
Rack1 cDNA ORF Clone, Mouse, C-Myc tag MG52808-CM
Rack1 cDNA ORF Clone, Mouse, N-Myc tag MG52808-NM

Rack1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Rack1 cDNA ORF Clone in Cloning Vector, Human HG16196-G
Rack1 cDNA ORF Clone, Human, untagged HG12498-G-N
Rack1 cDNA ORF Clone, Human, untagged HG16196-UT
Rack1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16196-ACG
Rack1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16196-ACR
Rack1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16196-CF
Rack1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16196-NF
Rack1 cDNA ORF Clone, Human, C-His tag HG16196-CH
Rack1 cDNA ORF Clone, Human, N-His tag HG16196-NH
Rack1 cDNA ORF Clone, Human, C-HA tag HG16196-CY
Rack1 cDNA ORF Clone, Human, N-HA tag HG16196-NY
Rack1 cDNA ORF Clone, Human, C-Myc tag HG16196-CM
Rack1 cDNA ORF Clone, Human, N-Myc tag HG16196-NM
Rack1 qPCR Primer Pairs, Human HP104818
info info
添加购物车成功! 添加购物车失败!