Quick Order

Mouse GMPR / GMPR1 Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Mouse GMPR cDNA Clone Product Information
    NCBI RefSeq:NM_025508.4
    RefSeq ORF Size:1038bp
    cDNA Description:Full length Clone DNA of Mus musculus guanosine monophosphate reductase.
    Gene Synonym:AV028449, 2310004P21Rik
    Species:Mouse
    Vector:pCMV3-untagged
    Plasmid:
    Restriction Site:
    Tag Sequence:
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with GMPR qPCR primers for gene expression analysis, MP201265 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    Background

    GMPR, also known as GMPR1, belongs to the IMPDH/GMPR family. This family of enzymes includes IMP dehydrogenase and GMP reductase. These enzymes are involved in purine metabolism and adopt a TIM barrel structure. GMPR is an enzyme that catalyzes the irreversible and NADPH-dependent reductive deamination of GMP to IMP. GMPR functions in the conversion of nucleobase, nucleoside and nucleotide derivatives of G to A nucleotides, and in maintaining the intracellular balance of A and G nucleotides.

    Size / Price
    Catalog: MG51395-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"