Glutamine Synthetase cDNA ORF Clone, Mouse, N-His tag

Cat: MG51496-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Glutamine Synthetase Reagents
CRO Services
Product recommended

All Glutamine Synthetase Reagents
Glutamine Synthetase cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1122 bp
Description
Full length Clone DNA of Mouse glutamate-ammonia ligase (glutamine synthetase) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Glutamine Synthetase cDNA ORF Clone, Mouse, N-His tag Alternative Names
Glns cDNA ORF Clone, Mouse;GS cDNA ORF Clone, Mouse
Glutamine Synthetase Background Information
Full Name
glutamate-ammonia ligase

Glutamine Synthetase cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
Glutamine Synthetase cDNA ORF Clone in Cloning Vector, Ferret FG60062-G
Glutamine Synthetase cDNA ORF Clone, Ferret, untagged FG60062-UT
Glutamine Synthetase Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60062-ACGLN
Glutamine Synthetase cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60062-ACG
Glutamine Synthetase cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60062-ANG
Glutamine Synthetase cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60062-ACR
Glutamine Synthetase cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60062-ANR
Glutamine Synthetase cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60062-CF
Glutamine Synthetase cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60062-NF
Glutamine Synthetase cDNA ORF Clone, Ferret, C-His tag FG60062-CH
Glutamine Synthetase cDNA ORF Clone, Ferret, N-His tag FG60062-NH
Glutamine Synthetase cDNA ORF Clone, Ferret, C-HA tag FG60062-CY
Glutamine Synthetase cDNA ORF Clone, Ferret, N-HA tag FG60062-NY
Glutamine Synthetase cDNA ORF Clone, Ferret, C-Myc tag FG60062-CM
Glutamine Synthetase cDNA ORF Clone, Ferret, N-Myc tag FG60062-NM

Glutamine Synthetase cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
Glutamine Synthetase cDNA ORF Clone in Cloning Vector, Cynomolgus CG90780-G
Glutamine Synthetase cDNA ORF Clone, Cynomolgus, untagged CG90780-UT
Glutamine Synthetase Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90780-ACGLN
Glutamine Synthetase cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90780-ACG
Glutamine Synthetase cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90780-ANG
Glutamine Synthetase cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90780-ACR
Glutamine Synthetase cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90780-ANR
Glutamine Synthetase cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90780-CF
Glutamine Synthetase cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90780-NF
Glutamine Synthetase cDNA ORF Clone, Cynomolgus, C-His tag CG90780-CH
Glutamine Synthetase cDNA ORF Clone, Cynomolgus, N-His tag CG90780-NH
Glutamine Synthetase cDNA ORF Clone, Cynomolgus, C-HA tag CG90780-CY
Glutamine Synthetase cDNA ORF Clone, Cynomolgus, N-HA tag CG90780-NY
Glutamine Synthetase cDNA ORF Clone, Cynomolgus, C-Myc tag CG90780-CM
Glutamine Synthetase cDNA ORF Clone, Cynomolgus, N-Myc tag CG90780-NM

Glutamine Synthetase cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Glutamine Synthetase cDNA ORF Clone in Cloning Vector, Rat RG80841-U
Glutamine Synthetase cDNA ORF Clone, Rat, untagged RG80841-UT
Glutamine Synthetase cDNA ORF Clone, Rat, C-GFPSpark® tag RG80841-ACG
Glutamine Synthetase Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80841-ACGLN
Glutamine Synthetase cDNA ORF Clone, Rat, N-GFPSpark® tag RG80841-ANG
Glutamine Synthetase cDNA ORF Clone, Rat, C-OFPSpark® tag RG80841-ACR
Glutamine Synthetase cDNA ORF Clone, Rat, N-OFPSpark® tag RG80841-ANR
Glutamine Synthetase cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80841-CF
Glutamine Synthetase cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80841-NF
Glutamine Synthetase cDNA ORF Clone, Rat, C-His tag RG80841-CH
Glutamine Synthetase cDNA ORF Clone, Rat, N-His tag RG80841-NH
Glutamine Synthetase cDNA ORF Clone, Rat, C-HA tag RG80841-CY
Glutamine Synthetase cDNA ORF Clone, Rat, N-HA tag RG80841-NY
Glutamine Synthetase cDNA ORF Clone, Rat, C-Myc tag RG80841-CM
Glutamine Synthetase cDNA ORF Clone, Rat, N-Myc tag RG80841-NM
Glutamine Synthetase qPCR Primer Pairs, Rat RP300805

Glutamine Synthetase cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Glutamine Synthetase cDNA ORF Clone in Cloning Vector, Mouse MG51496-U
Glutamine Synthetase cDNA ORF Clone, Mouse, untagged MG51496-UT
Glutamine Synthetase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51496-ACG
Glutamine Synthetase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51496-ACGLN
Glutamine Synthetase cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51496-ANG
Glutamine Synthetase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51496-ACR
Glutamine Synthetase cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51496-ANR
Glutamine Synthetase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51496-CF
Glutamine Synthetase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51496-NF
Glutamine Synthetase cDNA ORF Clone, Mouse, C-His tag MG51496-CH
Glutamine Synthetase cDNA ORF Clone, Mouse, C-HA tag MG51496-CY
Glutamine Synthetase cDNA ORF Clone, Mouse, N-HA tag MG51496-NY
Glutamine Synthetase cDNA ORF Clone, Mouse, C-Myc tag MG51496-CM
Glutamine Synthetase cDNA ORF Clone, Mouse, N-Myc tag MG51496-NM
Glutamine Synthetase qPCR Primer Pairs, Mouse MP201380

Glutamine Synthetase cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Glutamine Synthetase cDNA ORF Clone in Cloning Vector, Human HG14108-G
Glutamine Synthetase cDNA ORF Clone, Human, untagged HG14108-UT
Glutamine Synthetase cDNA ORF Clone, Human, C-GFPSpark® tag HG14108-ACG
Glutamine Synthetase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14108-ACGLN
Glutamine Synthetase cDNA ORF Clone, Human, N-GFPSpark® tag HG14108-ANG
Glutamine Synthetase cDNA ORF Clone, Human, C-OFPSpark® tag HG14108-ACR
Glutamine Synthetase cDNA ORF Clone, Human, N-OFPSpark® tag HG14108-ANR
Glutamine Synthetase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14108-CF
Glutamine Synthetase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14108-NF
Glutamine Synthetase cDNA ORF Clone, Human, C-His tag HG14108-CH
Glutamine Synthetase cDNA ORF Clone, Human, N-His tag HG14108-NH
Glutamine Synthetase cDNA ORF Clone, Human, C-HA tag HG14108-CY
Glutamine Synthetase cDNA ORF Clone, Human, N-HA tag HG14108-NY
Glutamine Synthetase cDNA ORF Clone, Human, C-Myc tag HG14108-CM
Glutamine Synthetase cDNA ORF Clone, Human, N-Myc tag HG14108-NM
Glutamine Synthetase qPCR Primer Pairs, Human HP102761
info info
添加购物车成功! 添加购物车失败!