GLT8D1 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52621-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GLT8D1 Reagents
CRO Services
Product recommended

All GLT8D1 Reagents
GLT8D1 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1116 bp
Description
Full length Clone DNA of Mouse glycosyltransferase 8 domain containing 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GLT8D1 cDNA ORF Clone, Mouse, N-His tag Alternative Names
2410004H05Rik cDNA ORF Clone, Mouse;5430414N14Rik cDNA ORF Clone, Mouse;AI450005 cDNA ORF Clone, Mouse
GLT8D1 Background Information
Full Name
glycosyltransferase 8 domain containing 1

GLT8D1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GLT8D1 cDNA ORF Clone in Cloning Vector, Mouse MG52621-G
GLT8D1 cDNA ORF Clone, Mouse, untagged MG52621-UT
GLT8D1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52621-ACG
GLT8D1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52621-ACGLN
GLT8D1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52621-ACR
GLT8D1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52621-CF
GLT8D1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52621-NF
GLT8D1 cDNA ORF Clone, Mouse, C-His tag MG52621-CH
GLT8D1 cDNA ORF Clone, Mouse, C-HA tag MG52621-CY
GLT8D1 cDNA ORF Clone, Mouse, N-HA tag MG52621-NY
GLT8D1 cDNA ORF Clone, Mouse, C-Myc tag MG52621-CM
GLT8D1 cDNA ORF Clone, Mouse, N-Myc tag MG52621-NM
GLT8D1 qPCR Primer Pairs, Mouse MP202492

GLT8D1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GLT8D1 cDNA ORF Clone in Cloning Vector, Human HG15843-G
GLT8D1 cDNA ORF Clone, Human, untagged HG15843-UT
GLT8D1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15843-ACGLN
GLT8D1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15843-ACG
GLT8D1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15843-ACR
GLT8D1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15843-CF
GLT8D1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15843-NF
GLT8D1 cDNA ORF Clone, Human, C-His tag HG15843-CH
GLT8D1 cDNA ORF Clone, Human, N-His tag HG15843-NH
GLT8D1 cDNA ORF Clone, Human, C-HA tag HG15843-CY
GLT8D1 cDNA ORF Clone, Human, N-HA tag HG15843-NY
GLT8D1 cDNA ORF Clone, Human, C-Myc tag HG15843-CM
GLT8D1 cDNA ORF Clone, Human, N-Myc tag HG15843-NM
GLT8D1 qPCR Primer Pairs, Human HP104434
info info
添加购物车成功! 添加购物车失败!