GLRB cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52674-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GLRB Reagents
CRO Services
Product recommended

All GLRB Reagents
GLRB cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1491 bp
Description
Full length Clone DNA of Mouse glycine receptor, beta subunit with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GLRB cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
AI853901 cDNA ORF Clone, Mouse;Glyrb cDNA ORF Clone, Mouse;spa cDNA ORF Clone, Mouse;spastic cDNA ORF Clone, Mouse
GLRB Background Information
Full Name
glycine receptor, beta subunit

GLRB cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GLRB cDNA ORF Clone in Cloning Vector, Mouse MG52674-G
GLRB cDNA ORF Clone, Mouse, untagged MG52674-UT
GLRB Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52674-ACGLN
GLRB cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52674-ACG
GLRB cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52674-ACR
GLRB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52674-CF
GLRB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52674-NF
GLRB cDNA ORF Clone, Mouse, C-His tag MG52674-CH
GLRB cDNA ORF Clone, Mouse, N-His tag MG52674-NH
GLRB cDNA ORF Clone, Mouse, C-HA tag MG52674-CY
GLRB cDNA ORF Clone, Mouse, N-HA tag MG52674-NY
GLRB cDNA ORF Clone, Mouse, C-Myc tag MG52674-CM
GLRB qPCR Primer Pairs, Mouse MP202545

GLRB cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GLRB cDNA ORF Clone in Cloning Vector, Human HG16619-U
GLRB cDNA ORF Clone, Human, untagged HG16619-UT
GLRB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16619-ACGLN
GLRB cDNA ORF Clone, Human, C-GFPSpark® tag HG16619-ACG
GLRB cDNA ORF Clone, Human, C-OFPSpark® tag HG16619-ACR
GLRB cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16619-CF
GLRB cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16619-NF
GLRB cDNA ORF Clone, Human, C-His tag HG16619-CH
GLRB cDNA ORF Clone, Human, N-His tag HG16619-NH
GLRB cDNA ORF Clone, Human, C-HA tag HG16619-CY
GLRB cDNA ORF Clone, Human, N-HA tag HG16619-NY
GLRB cDNA ORF Clone, Human, C-Myc tag HG16619-CM
GLRB cDNA ORF Clone, Human, N-Myc tag HG16619-NM
info info
添加购物车成功! 添加购物车失败!