GLO1 cDNA ORF Clone, Mouse, untagged

Cat: MG50364-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GLO1 Reagents
CRO Services
Product recommended

All GLO1 Reagents
GLO1 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
555 bp
Description
Full length Clone DNA of Mouse glyoxalase 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GLO1 cDNA ORF Clone, Mouse, untagged Alternative Names
0610009E22Rik cDNA ORF Clone, Mouse;1110008E19Rik cDNA ORF Clone, Mouse;2510049H23Rik cDNA ORF Clone, Mouse;AW550643 cDNA ORF Clone, Mouse;Glo-1 cDNA ORF Clone, Mouse;Glo-1r cDNA ORF Clone, Mouse;Glo-1s cDNA ORF Clone, Mouse;Glo1-r cDNA ORF Clone, Mouse;Glo1-s cDNA ORF Clone, Mouse;GLY1 cDNA ORF Clone, Mouse;Qglo cDNA ORF Clone, Mouse
GLO1 Background Information

Lactoylglutathione lyase, also known as Methylglyoxalase, Aldoketomutase, Glyoxalase I, Ketone-aldehyde mutase, S-D-lactoylglutathione methylglyoxal lyase and GLO1, is a member of the glyoxalase I family. GLO1 / Glyoxalase I is a ubiquitous cellular defense enzyme involved in the detoxification of methylglyoxal, a cytotoxic byproduct of glycolysis. Accumulative evidence suggests an important role of GLO1 expression in protection against methylglyoxal-dependent protein adduction and cellular damage associated with diabetes, cancer, and chronological aging. GLO1 / Glyoxalase I has been implicated in anxiety-like behavior in mice and in multiple psychiatric diseases in humans. GLO1 / Glyoxalase I catalyzes the conversion of hemimercaptal, formed from methylglyoxal and glutathione, to S-lactoylglutathione. GLO1 / Glyoxalase I exists in three separable isoforms which originate from two alleles in the genome. These correspond to two homodimers and one heterodimer composed of two subunits showing different electrophoretic properties. GLO1 upregulation may play a functional role in glycolytic adaptations of cancer cells.

Full Name
glyoxalase I
References
  • Wu, YY. et al., 2008,Prog Neuropsychopharmacol Biol Psychiatry. 32 (7):1740-4.
  • Williams,R. et al., 2009, PLoS One  4 (3): e4649.
  • Antognelli,C. et al., 2009, BMC Cancer  9 :115.
  • Bair,W.B. et al., 2010, Melanoma Res  20 (2):85-96.
  • GLO1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    GLO1 cDNA ORF Clone in Cloning Vector, Mouse MG50364-M
    GLO1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50364-ACG
    GLO1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50364-ACGLN
    GLO1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50364-ANG
    GLO1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50364-ACR
    GLO1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50364-ANR
    GLO1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50364-CF
    GLO1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50364-NF
    GLO1 cDNA ORF Clone, Mouse, C-His tag MG50364-CH
    GLO1 cDNA ORF Clone, Mouse, N-His tag MG50364-NH
    GLO1 cDNA ORF Clone, Mouse, C-HA tag MG50364-CY
    GLO1 cDNA ORF Clone, Mouse, N-HA tag MG50364-NY
    GLO1 cDNA ORF Clone, Mouse, C-Myc tag MG50364-CM
    GLO1 cDNA ORF Clone, Mouse, N-Myc tag MG50364-NM
    GLO1 qPCR Primer Pairs, Mouse MP200082

    GLO1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    GLO1 cDNA ORF Clone in Cloning Vector, Human HG12223-G
    GLO1 cDNA ORF Clone, Human, untagged HG12223-UT
    GLO1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12223-ACGLN
    GLO1 cDNA ORF Clone, Human, C-GFPSpark® tag HG12223-ACG
    GLO1 cDNA ORF Clone, Human, N-GFPSpark® tag HG12223-ANG
    GLO1 cDNA ORF Clone, Human, C-OFPSpark® tag HG12223-ACR
    GLO1 cDNA ORF Clone, Human, N-OFPSpark® tag HG12223-ANR
    GLO1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12223-CF
    GLO1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12223-NF
    GLO1 cDNA ORF Clone, Human, C-His tag HG12223-CH
    GLO1 cDNA ORF Clone, Human, N-His tag HG12223-NH
    GLO1 cDNA ORF Clone, Human, C-HA tag HG12223-CY
    GLO1 cDNA ORF Clone, Human, N-HA tag HG12223-NY
    GLO1 cDNA ORF Clone, Human, C-Myc tag HG12223-CM
    GLO1 cDNA ORF Clone, Human, N-Myc tag HG12223-NM
    GLO1 qPCR Primer Pairs, Human HP101855
    info info
    添加购物车成功! 添加购物车失败!