Growth Hormone Receptor cDNA ORF Clone, Mouse, N-HA tag

Cat: MG50043-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Growth Hormone Receptor Reagents
CRO Services
Product recommended

All Growth Hormone Receptor Reagents
Growth Hormone Receptor cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1953 bp
Description
Full length Clone DNA of Mouse growth hormone receptor, transcript variant 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Growth Hormone Receptor cDNA ORF Clone, Mouse, N-HA tag Alternative Names
GHBP cDNA ORF Clone, Mouse;GHR/BP cDNA ORF Clone, Mouse
Growth Hormone Receptor Background Information

Growth hormone receptor, also known as GH receptor and GHR, is a single-pass type I  membrane protein which belongs to the type I  cytokine receptor family and type 1 subfamily. GHR contains one fibronectin type-III domain. Growth hormone receptor / GHR is expressed in various tissues with high expression in liver and skeletal muscle. Isoform 4 of GHR is predominantly expressed in kidney, bladder, adrenal gland and brain stem. Isoform 1 expression of GHR in placenta is predominant in chorion and decidua. Isoform 4 is highly expressed in placental villi. Isoform 2 of GHR is expressed in lung, stomach and muscle. Growth hormone receptor / GHR is a receptor for pituitary gland growth hormone. It is involved in regulating postnatal body growth. On ligand binding, it couples to the JAK2 / STAT5 pathway. Isoform 2 of GHR up-regulates the production of GHBP and acts as a negative inhibitor of GH signaling. Defects in GHR are a cause of Laron syndrome (LARS) which is a severe form of growth hormone insensitivity characterized by growth impairment, short stature, dysfunctional growth hormone receptor, and failure to generate insulin-like growth factor I in response to growth hormone. Defects in GHR may also be a cause of idiopathic short stature autosomal (ISSA) which is defined by a subnormal rate of growth.

Full Name
growth hormone receptor
References
  • Leung DW. et al., 1987, Nature. 330:537-43.
  • Sobrier M-L. et al., 1997, J Clin Endocrinol Metab. 82: 435-7.
  • Enberg B. et al., 2000, Eur J Endocrinol. 143: 71-6.
  • Pantel J. et al., 2000, J Biol Chem. 275: 18664-9.
  • Jorge AAL. et al., 2004, Clin Endocrinol. (Oxf.) 60: 36-40.
  • Growth Hormone Receptor cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Growth Hormone Receptor cDNA ORF Clone in Cloning Vector, Rat RG80029-M
    Growth Hormone Receptor cDNA ORF Clone, Rat, untagged RG80029-UT
    Growth Hormone Receptor Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80029-ACGLN
    Growth Hormone Receptor cDNA ORF Clone, Rat, C-GFPSpark® tag RG80029-ACG
    Growth Hormone Receptor cDNA ORF Clone, Rat, C-OFPSpark® tag RG80029-ACR
    Growth Hormone Receptor cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80029-CF
    Growth Hormone Receptor cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80029-NF
    Growth Hormone Receptor cDNA ORF Clone, Rat, C-His tag RG80029-CH
    Growth Hormone Receptor cDNA ORF Clone, Rat, N-His tag RG80029-NH
    Growth Hormone Receptor cDNA ORF Clone, Rat, C-HA tag RG80029-CY
    Growth Hormone Receptor cDNA ORF Clone, Rat, N-HA tag RG80029-NY
    Growth Hormone Receptor cDNA ORF Clone, Rat, C-Myc tag RG80029-CM
    Growth Hormone Receptor cDNA ORF Clone, Rat, N-Myc tag RG80029-NM
    Growth Hormone Receptor qPCR Primer Pairs, Rat RP300028

    Growth Hormone Receptor cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Growth Hormone Receptor cDNA ORF Clone in Cloning Vector, Mouse MG50043-M
    Growth Hormone Receptor cDNA ORF Clone, Mouse, untagged MG50043-UT
    Growth Hormone Receptor cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50043-ACG
    Growth Hormone Receptor Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50043-ACGLN
    Growth Hormone Receptor cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50043-ACR
    Growth Hormone Receptor cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50043-CF
    Growth Hormone Receptor cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50043-NF
    Growth Hormone Receptor cDNA ORF Clone, Mouse, C-His tag MG50043-CH
    Growth Hormone Receptor cDNA ORF Clone, Mouse, N-His tag MG50043-NH
    Growth Hormone Receptor cDNA ORF Clone, Mouse, C-HA tag MG50043-CY
    Growth Hormone Receptor cDNA ORF Clone, Mouse, C-Myc tag MG50043-CM
    Growth Hormone Receptor cDNA ORF Clone, Mouse, N-Myc tag MG50043-NM
    Growth Hormone Receptor qPCR Primer Pairs, Mouse MP200043

    Growth Hormone Receptor cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Growth Hormone Receptor cDNA ORF Clone in Cloning Vector, Human HG17302-G
    info info
    添加购物车成功! 添加购物车失败!