GHITM/MICS1 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52894-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GHITM/MICS1 Reagents
CRO Services
Product recommended

All GHITM/MICS1 Reagents
GHITM/MICS1 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1041 bp
Description
Full length Clone DNA of Mouse growth hormone inducible transmembrane protein with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GHITM/MICS1 cDNA ORF Clone, Mouse, N-His tag Alternative Names
1010001P14Rik cDNA ORF Clone, Mouse;C77840 cDNA ORF Clone, Mouse;MICS1 cDNA ORF Clone, Mouse;PTD010 cDNA ORF Clone, Mouse;Tmbim5 cDNA ORF Clone, Mouse
GHITM/MICS1 Background Information
Full Name
growth hormone inducible transmembrane protein

GHITM/MICS1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GHITM/MICS1 cDNA ORF Clone in Cloning Vector, Rat RG87447-U
GHITM/MICS1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG87447-ACGLN

GHITM/MICS1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GHITM/MICS1 cDNA ORF Clone in Cloning Vector, Mouse MG52894-G
GHITM/MICS1 cDNA ORF Clone, Mouse, untagged MG52894-UT
GHITM/MICS1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52894-ACGLN
GHITM/MICS1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52894-ACG
GHITM/MICS1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52894-ANG
GHITM/MICS1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52894-ACR
GHITM/MICS1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52894-ANR
GHITM/MICS1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52894-CF
GHITM/MICS1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52894-NF
GHITM/MICS1 cDNA ORF Clone, Mouse, C-His tag MG52894-CH
GHITM/MICS1 cDNA ORF Clone, Mouse, C-HA tag MG52894-CY
GHITM/MICS1 cDNA ORF Clone, Mouse, N-HA tag MG52894-NY
GHITM/MICS1 cDNA ORF Clone, Mouse, C-Myc tag MG52894-CM
GHITM/MICS1 cDNA ORF Clone, Mouse, N-Myc tag MG52894-NM

GHITM/MICS1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GHITM/MICS1 cDNA ORF Clone in Cloning Vector, Human HG16397-G
GHITM/MICS1 cDNA ORF Clone, Human, untagged HG16397-UT
GHITM/MICS1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16397-ACGLN
GHITM/MICS1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16397-ACG
GHITM/MICS1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16397-ANG
GHITM/MICS1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16397-ACR
GHITM/MICS1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16397-ANR
GHITM/MICS1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16397-CF
GHITM/MICS1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16397-NF
GHITM/MICS1 cDNA ORF Clone, Human, C-His tag HG16397-CH
GHITM/MICS1 cDNA ORF Clone, Human, N-His tag HG16397-NH
GHITM/MICS1 cDNA ORF Clone, Human, C-HA tag HG16397-CY
GHITM/MICS1 cDNA ORF Clone, Human, N-HA tag HG16397-NY
GHITM/MICS1 cDNA ORF Clone, Human, C-Myc tag HG16397-CM
GHITM/MICS1 cDNA ORF Clone, Human, N-Myc tag HG16397-NM
GHITM/MICS1 qPCR Primer Pairs, Human HP105146
info info
添加购物车成功! 添加购物车失败!