GATAD1 cDNA ORF Clone, Mouse, untagged

Cat: MG51460-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GATAD1 Reagents
CRO Services
Product recommended

All GATAD1 Reagents
GATAD1 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
801 bp
Description
Full length Clone DNA of Mouse GATA zinc finger domain containing 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GATAD1 cDNA ORF Clone, Mouse, untagged Alternative Names
2310031E19Rik cDNA ORF Clone, Mouse;2810047M21Rik cDNA ORF Clone, Mouse;8430439A17Rik cDNA ORF Clone, Mouse;9130430G15Rik cDNA ORF Clone, Mouse;B330017N08Rik cDNA ORF Clone, Mouse;ENSMUSG00000073241 cDNA ORF Clone, Mouse;Odag cDNA ORF Clone, Mouse
GATAD1 Background Information
Full Name
GATA zinc finger domain containing 1

GATAD1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GATAD1 cDNA ORF Clone in Cloning Vector, Mouse MG51460-G
GATAD1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51460-ACGLN
GATAD1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51460-ACG
GATAD1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51460-ANG
GATAD1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51460-ACR
GATAD1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51460-ANR
GATAD1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51460-CF
GATAD1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51460-NF
GATAD1 cDNA ORF Clone, Mouse, C-His tag MG51460-CH
GATAD1 cDNA ORF Clone, Mouse, N-His tag MG51460-NH
GATAD1 cDNA ORF Clone, Mouse, C-HA tag MG51460-CY
GATAD1 cDNA ORF Clone, Mouse, N-HA tag MG51460-NY
GATAD1 cDNA ORF Clone, Mouse, C-Myc tag MG51460-CM
GATAD1 cDNA ORF Clone, Mouse, N-Myc tag MG51460-NM
GATAD1 qPCR Primer Pairs, Mouse MP201344

GATAD1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GATAD1 cDNA ORF Clone in Cloning Vector, Human HG18383-U
GATAD1 cDNA ORF Clone, Human, untagged HG18383-UT
GATAD1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18383-ACGLN
GATAD1 cDNA ORF Clone, Human, C-GFPSpark® tag HG18383-ACG
GATAD1 cDNA ORF Clone, Human, N-GFPSpark® tag HG18383-ANG
GATAD1 cDNA ORF Clone, Human, C-OFPSpark® tag HG18383-ACR
GATAD1 cDNA ORF Clone, Human, N-OFPSpark® tag HG18383-ANR
GATAD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG18383-CF
GATAD1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG18383-NF
GATAD1 cDNA ORF Clone, Human, C-His tag HG18383-CH
GATAD1 cDNA ORF Clone, Human, N-His tag HG18383-NH
GATAD1 cDNA ORF Clone, Human, C-HA tag HG18383-CY
GATAD1 cDNA ORF Clone, Human, N-HA tag HG18383-NY
GATAD1 cDNA ORF Clone, Human, C-Myc tag HG18383-CM
GATAD1 cDNA ORF Clone, Human, N-Myc tag HG18383-NM
info info
添加购物车成功! 添加购物车失败!