GART/Glycinamide ribonucleotide transformylase cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52285-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GART/Glycinamide ribonucleotide transformylase Reagents
CRO Services
Product recommended

All GART/Glycinamide ribonucleotide transformylase Reagents
GART/Glycinamide ribonucleotide transformylase cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1302 bp
Description
Full length Clone DNA of Mouse phosphoribosylglycinamide formyltransferase with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GART/Glycinamide ribonucleotide transformylase cDNA ORF Clone, Mouse, N-HA tag Alternative Names
Gaps cDNA ORF Clone, Mouse;Prgs cDNA ORF Clone, Mouse
GART/Glycinamide ribonucleotide transformylase Background Information
Full Name
phosphoribosylglycinamide formyltransferase

GART/Glycinamide ribonucleotide transformylase cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GART/Glycinamide ribonucleotide transformylase cDNA ORF Clone in Cloning Vector, Mouse MG52285-G
GART/Glycinamide ribonucleotide transformylase cDNA ORF Clone, Mouse, untagged MG52285-UT
GART/Glycinamide ribonucleotide transformylase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52285-ACG
GART/Glycinamide ribonucleotide transformylase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52285-ACGLN
GART/Glycinamide ribonucleotide transformylase cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52285-ANG
GART/Glycinamide ribonucleotide transformylase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52285-ACR
GART/Glycinamide ribonucleotide transformylase cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52285-ANR
GART/Glycinamide ribonucleotide transformylase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52285-CF
GART/Glycinamide ribonucleotide transformylase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52285-NF
GART/Glycinamide ribonucleotide transformylase cDNA ORF Clone, Mouse, C-His tag MG52285-CH
GART/Glycinamide ribonucleotide transformylase cDNA ORF Clone, Mouse, N-His tag MG52285-NH
GART/Glycinamide ribonucleotide transformylase cDNA ORF Clone, Mouse, C-HA tag MG52285-CY
GART/Glycinamide ribonucleotide transformylase cDNA ORF Clone, Mouse, C-Myc tag MG52285-CM
GART/Glycinamide ribonucleotide transformylase cDNA ORF Clone, Mouse, N-Myc tag MG52285-NM
GART/Glycinamide ribonucleotide transformylase qPCR Primer Pairs, Mouse MP202158

GART/Glycinamide ribonucleotide transformylase cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GART/Glycinamide ribonucleotide transformylase cDNA ORF Clone in Cloning Vector, Human HG19133-U
GART/Glycinamide ribonucleotide transformylase cDNA ORF Clone, Human, untagged HG19133-UT
GART/Glycinamide ribonucleotide transformylase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG19133-ACGLN
GART/Glycinamide ribonucleotide transformylase cDNA ORF Clone, Human, C-GFPSpark® tag HG19133-ACG
GART/Glycinamide ribonucleotide transformylase cDNA ORF Clone, Human, N-GFPSpark® tag HG19133-ANG
GART/Glycinamide ribonucleotide transformylase cDNA ORF Clone, Human, C-OFPSpark® tag HG19133-ACR
GART/Glycinamide ribonucleotide transformylase cDNA ORF Clone, Human, N-OFPSpark® tag HG19133-ANR
GART/Glycinamide ribonucleotide transformylase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG19133-CF
GART/Glycinamide ribonucleotide transformylase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG19133-NF
GART/Glycinamide ribonucleotide transformylase cDNA ORF Clone, Human, C-His tag HG19133-CH
GART/Glycinamide ribonucleotide transformylase cDNA ORF Clone, Human, N-His tag HG19133-NH
GART/Glycinamide ribonucleotide transformylase cDNA ORF Clone, Human, C-HA tag HG19133-CY
GART/Glycinamide ribonucleotide transformylase cDNA ORF Clone, Human, N-HA tag HG19133-NY
GART/Glycinamide ribonucleotide transformylase cDNA ORF Clone, Human, C-Myc tag HG19133-CM
GART/Glycinamide ribonucleotide transformylase cDNA ORF Clone, Human, N-Myc tag HG19133-NM
info info
添加购物车成功! 添加购物车失败!